Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
Minerals can form in all geological environments, which allows them to have a wide range of chemical and physical conditions. Two forms of this are temperature and pressure. There are 4 main categories of mineral formations. Igneous is where the minerals crystalize from a melt. Sedimentary is where the raw materials of the mineral are particles from other rocks that have suffered from erosion and weathering. Metamorphic is where new minerals are created from earlier ones owing to the effects of change. Most of the time it's from increasing temperature and/or pressure. Hydrothermal is where the minerals are chemically precipitated from hot solutions in the earth.
Answer:
Roughage
Explanation:
Hope this helps :)-Mark Brainiest Please! Thanks!!
Call you later today I have a lot to talk about it
