1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
irakobra [83]
3 years ago
12

What drives the process of plate tectonics?

Biology
1 answer:
Len [333]3 years ago
8 0

Answer:

it's A

Explanation:

I searched it up

You might be interested in
John enjoys experimenting with color changing lizards. He places a green lizard on a brown background and a brown lizard on a gr
Gnoma [55]
Well the lizards might not feel threatened. when a lizard or chameleon change due to a chemical reaction in there skin it is made that way based off of the emotion that creates there skin to change colors, but it is a survival instinct so it happens due to there sense of danger  <span />
4 0
3 years ago
Need help pls due <br> Pls help
Ahat [919]

Answer:

This may be the case because of the placements of the spread. While one is more cluttered, the other is a bit more spread apart. Meaning that the GeoChart on the right must have more cases, exactly because of their population.

8 0
3 years ago
Read 2 more answers
Examine the picture below. What is structure "G"?
IgorC [24]

Answer:

<u>Structure G</u> is Option (c) : Vacuole

7 0
4 years ago
Read 2 more answers
List four characteristics that are representative of most primates and lead paleoanthropology to conclude that primates share a
lesya [120]

Answer:

- prehensile hands and feet

- five digits and opposable thumbs

- flexible and limber shoulders and hips

- big and complex brains

Explanation:

The primates are the most intelligent animals collectively, and they include the most intelligent animal on the planet, the human. All of them share some common characteristics that lead the paleoanthropology to conclude that they share a common ancestor. Most of them have prehensile hands and feet, which is a rare among other groups of animals. Almost all of them have five digits on their hands and feet, possessing opposible thumbs as well, enabling them to grab things. The shoulders and hips are also much different than the other animals, being much more flexible and limber. The most important characteristic maybe is their brain, as it is abnormally large and complex when compared with other animals of the same sizes. Their complex brains enable them to perform numerous things that other animals can't even imagine, and eventually that large brain helped in creating the most intelligent animal on the planet, the human.

8 0
3 years ago
Read 2 more answers
The gastrointestinal system digest ingested food and gets rid of any wastes after the food is digested. True or false?
valkas [14]

True is the final answer!!!! :)

3 0
4 years ago
Other questions:
  • Does the perfume diffusion from high concentration to low concentration
    8·1 answer
  • Name all five levels of organization in the human body
    13·2 answers
  • During photosynthesis, light energy becomes what?
    13·1 answer
  • Help me i need it hurry please
    12·2 answers
  • What is the first thing you do with the rat in the procedure section?
    11·1 answer
  • What is the definition of Organelle? And what could be a good example?
    9·1 answer
  • The molecules that make the cell surface fuzzy, sticky, and sugar-rich are
    5·1 answer
  • Translate the mRNA of the above (Question 2) transcription. ... 3' tcgccctactcgcgtacaccgcgtattgac 5' turns into:
    7·1 answer
  • Which is not an example of matter and energy cycling through living things
    11·2 answers
  • Explain how keystone species and ecosystem engineers affect life in an ecosystem
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!