1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
koban [17]
3 years ago
13

What are the major evolutionary trends that developed among major vertebrate groups?

Biology
1 answer:
aliya0001 [1]3 years ago
6 0

Answer:

Many evolutionary changes resulted in the transition of aquatic vertebrates into terrestrial organisms. Some of these are:

  • Improved respiration

In terrestrial organisms, the respiratory system is more complex and enhanced than the aquatic vertebrates. For instance, the early amphibians had gills for respiration. But with the passage of time, lungs appeared which made life on land more feasible.

  • Body coverings

The formation of rigid and insulated body coverings also was an adaptation that emerged for making life feasible on land.

  • Development of limbs

Limbs allowed movement on land. With the passage of time, feet developed from the limbs.

You might be interested in
Directions
Mashutka [201]

Reviewing of articles summarizes the current state of understanding on a topic within a certain discipline.  

<h3>What is an article review?</h3>

This is a type of professional paper writing which demands a high level of in-depth analysis and a well-structured presentation of arguments and a critical evaluation of literature in a particular field through summary, classification, analysis, and comparison.

<h3>Introducing the main idea of an article:</h3>

The first sentence should explain the subject being discussed in the passage.

A signal phrase is a short introductory phrase that indicates that a quote or paraphrase is coming. To introduce a signal phrase, you provide an effective transition between your own ideas and the evidence used to explore your ideas.

To include a quote, use the author's last name and the page number from which the quotation or paraphrase is taken.

To include a sentence which discusses the quote chosen, you:

  • Use a full sentence followed by a colon to introduce a quotation.
  • Begin a sentence with your own words, then complete it with quoted words.
  • Use an introductory phrase naming the source, followed by a comma to quote a critic or researcher.

Hence, a review article is generally considered a secondary source since it may analyze and discuss the method and conclusions in previously published studies.

Read more about the <em>article review</em> here:

brainly.com/question/14443228

#SPJ1

4 0
2 years ago
Mama at least three forms of force when dropping a ball on the ground​
Darya [45]

Answer:

Explained below.

Explanation:

At least three forms of force when dropping a ball on the ground​ are gravitational force, air resistance force and the buoyancy force as well.

→ Gravitational force is a type of force that is acting while the ball is dropping, that is the downward force which is attracting the ball towards the centre of the surface of the earth.

→ Air resistance force is the upward force that will be acting while the ball is dropping on the ground.

→ The buoyancy force is the type of force that will act when the ball will touch the ground, then due to buoyancy force, the ball will bounce.

6 0
4 years ago
From 1787 until the passage of the 17th Amendment in 1913, Senate members were selected by __________.
Aleksandr-060686 [28]
The people of the united states
5 0
4 years ago
Read 2 more answers
What do the fungus that causes athlete's foot, the tick that spreads Lyme disease, and body lice all have in common
Tanya [424]
The common difference between them is that they are all bacteria.
Hope it’s helps
5 0
3 years ago
Which method would the nurse use to administer cyclobenzaprine to facilitate the greatest amount of absorption?.
12345 [234]

The method that would the nurse use to administer cyclobenzaprine to facilitate the greatest amount of absorption is administering it on an empty stomach.

<h3>What is cyclobenzaprine?</h3>

Cyclobenzaprine may be defined as a kind of medication that is operated for muscle cramps from musculoskeletal conditions of impulsive beginning. It is a type of muscle relaxant drug.

An empty stomach gives a better absorption of a specific medication into its target sites. It overall analyzed the concentration of deposited cyclobenzaprine to facilitate the greatest amount of absorption.

Therefore, it is well described above.

To learn more about cyclobenzaprine, refer to the link:

brainly.com/question/26770650

#SPJ1

4 0
2 years ago
Other questions:
  • What do you know about a chemical compound by looking at its chemical formula?
    9·1 answer
  • Where would a probe with the sequence AATCG bind to a target DNA with the sequence TTTTAGCCATTTACGATTAATCG (recall that DNA sequ
    12·1 answer
  • Which of the following is not in the phylum Chordata?
    5·1 answer
  • Which statement best describes the weather shown by the red semicircle on a line on a weather map?
    7·2 answers
  • A density-independent factor happens:
    10·1 answer
  • Why aren't there many large carnivores?
    5·1 answer
  • The figure below shows an experiment on photosynthesis. Rebecca observed that the part of the leaf outside the bottle showed the
    6·2 answers
  • What types of areas did Spanish Explorers look for when they set up colonies
    9·2 answers
  • Light causes the same change to all matter/materials. *<br> True<br> O False
    5·1 answer
  • What are 4 cellular activities that would require the energy of ATP?
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!