1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rzqust [24]
3 years ago
6

2. Fill in the table below by writing the complementary strand of DNA that would be formed by each

English
1 answer:
Musya8 [376]3 years ago
6 0

Answer:

By applying Chargaff's rule, which states that A only bonds with T and C only bonds with G in a DNA strand. One other factor that makes the rule true is because of the presence of hydrogen. Hydrogen ensure the bonding between the bases which holds the DNA Strands together.

Explanation:

By Applying Complementary Base-Pairing Rules, Let's say you have a DNA sequence of a specific gene on one strand of DNA. You can then use complementary base pairing rules to figure out the other DNA strand that makes up the DNA molecule. For example, let's say you have the following sequence:

AAGGGGTGACTCTAGTTTAATATA

You know that A and T are complements of each other and C and G are complements of each other. That means the DNA strand that pairs with the one above is:

TTCCCCACTGAGATCAAATTATAT

Use the rule and example and fill in the table.

You might be interested in
Mick fleetwood is best known as the cofounder and played the drums for the rock band fleetwood mac. what is wrong with the sente
Katarina [22]
I believe that what is wrong with the sentence is that it never says what he was the cofounder of - the order of the words in the sentence is a little funky. It should be rewritten like this:
Mick Fleetwood is best known as the cofounder of the rock band Fleetwood Mac, where he played the drums. 
5 0
3 years ago
Read 2 more answers
Define adjectives of place.​
Vaselesa [24]

Answer:

Adjectives that Describe Places - Intermediate Vocabulary

Explanation:

a word that describes a noun or pronoun:

More examples

In the sentence 'She is happy', 'happy' is a predicative adjective.

Complete the sentence with one of the adjectives provided.

You can change the adjective 'sweet' into a noun by adding the suffix '-ness' to the end of the word.

In 'a sudden movement', 'sudden' is an adjective in the attributive position.

I don't think I'd call it a beautiful picture - 'interesting' might be a better adjective to use!

PLS MARK ME BRAINLIEST

5 0
3 years ago
Which of these questions should be asked first (Who will be helped by this action? or Who would be harmed by this action)
Marianna [84]

Answer:

who will be helped

Explanation:

although people might get hurt in the process of an action it is best to ask who will be helped other than who will be hurt. some may get hurt in the process but as long as it is not to serious and that the positive is more than the negative

7 0
3 years ago
What element are you most likely to adjust about a presentation if you're
Fynjy0 [20]

Answer:

D.

That´s the answer so go suck some knowledge.

4 0
3 years ago
Read 2 more answers
COMPLETE THE SENTENCE "Girls Just wanna have fun so they....?"
gulaghasi [49]

Answer:Dance!

Explanation:Hope this helps!

8 0
4 years ago
Other questions:
  • 1.) What type of clause is used in the following sentence: His cupcakes look as if they are from another world.
    13·1 answer
  • When competing for admission to more selective four-year colleges, which of the following can be just important as a GPA?
    14·2 answers
  • What is the difference between ethos, logos and pathos
    8·1 answer
  • What are examples of social courage
    8·1 answer
  • What is the main character called? protagonist point of view antagonist denouement character dialogue
    9·2 answers
  • Which words best create a positive, hopeful tone?
    5·2 answers
  • What topic is Henry David Thoreau's "Resistance to Civil Government" primarily about?
    11·2 answers
  • Can someone help me???
    11·1 answer
  • Hey everyone, I know this is not a question, but can y'all please vote? It ends tomorrow. It's voting for teacher of the year. I
    15·2 answers
  • Read the following sentences. The Countess was tiny and dried-up her lips painted, little penetrating blue eyes, and great vivac
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!