1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rzqust [24]
3 years ago
6

2. Fill in the table below by writing the complementary strand of DNA that would be formed by each

English
1 answer:
Musya8 [376]3 years ago
6 0

Answer:

By applying Chargaff's rule, which states that A only bonds with T and C only bonds with G in a DNA strand. One other factor that makes the rule true is because of the presence of hydrogen. Hydrogen ensure the bonding between the bases which holds the DNA Strands together.

Explanation:

By Applying Complementary Base-Pairing Rules, Let's say you have a DNA sequence of a specific gene on one strand of DNA. You can then use complementary base pairing rules to figure out the other DNA strand that makes up the DNA molecule. For example, let's say you have the following sequence:

AAGGGGTGACTCTAGTTTAATATA

You know that A and T are complements of each other and C and G are complements of each other. That means the DNA strand that pairs with the one above is:

TTCCCCACTGAGATCAAATTATAT

Use the rule and example and fill in the table.

You might be interested in
HELP PLEAASEEE...
mihalych1998 [28]

Answer:

I think its A in so sorry if wrong

Explanation:

Good luck u can do it i beleve this is correct

5 0
3 years ago
Pick the best topic sentence for the following description paragraph:
sergeinik [125]

Answer:

An apple, potato, and onion all taste the same if you eat them with your nose plugged

Explanation:

7 0
3 years ago
Read 2 more answers
As the narrator tells the story—which certainly has its gruesome and fearful aspects—what tone prevails? Is it comic, frightenin
amid [387]

frightening and suspenseful

6 0
3 years ago
Read 2 more answers
Which of the following questions about "space exploration" would be considered a universal question?
8_murik_8 [283]

Answer:

I think C

Explanation:

3 0
3 years ago
Read 2 more answers
What does Freneau admire about the burial rites of Native Americans, as described in "The Indian Burying Ground"?
e-lub [12.9K]
He admired that the rites implied that the deceased will live actively after death. 
5 0
3 years ago
Read 2 more answers
Other questions:
  • Someone to help me please
    6·1 answer
  • How do people tell right from wrong in the Bad Behaviour's topic
    10·1 answer
  • Colonel Heathergall has only one eye.<br>True or False<br>(The rifles of the regiment)
    8·2 answers
  • Standing near the window, Joshua viewed the moving vans pull up next door. He couldn’t wait to meet his neighbors. Joshua saw a
    5·1 answer
  • Please help with this
    15·1 answer
  • Can verb phrases be transitive (Ex. are eating)?
    6·1 answer
  • 1. At any moment, a seemingly
    8·1 answer
  • Which statements accurately describe the sonnet’s rhyme scheme and its effects? Check all that apply.
    12·2 answers
  • The most effective tool for making a project schedule is a ____________ .
    11·2 answers
  • 60 POINTS !!! I NEED HELPPP
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!