<span>The yellow packets of tissue under the skin of a chicken allow the chicken to insulate from temperatures when the chicken is alive. It acts as a barrier against the weather. When the chicken is prepared to be cooked these pockets of fat are often left to keep the meat from drying out while the chicken is being cooked.</span>
Answer: Central America
Explanation:
In Belize right after Christmas we celebrate boxing day as a tradition, so i would say my hometown Central America(if wrong im sorry)
Answer:
- Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
- Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
- Translation: AUA UUA CUU CAA GGC UCC UAU
Explanation:
First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:
- Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
- Guanine (G) connects and is complemented by cytosine (C) and vice versa.
Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.
This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.
The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU
Answer:
Yes, that is very much true, just because climate change is caused mainly by changes in the balance between the amount of solar radiation received by Earth and the amount of heat radiated back into space by the Earth.
<em>"The change in stability of the environmental factors or the negative effects in the equilibrium inside the environment is called as the climate change."</em>
- <u>Global Warming And the green house effect:</u>
<em>"The overall rise in temperature of the earth spheres and its environment is termed as global warming, and its due the green house effect(the negative effect due to the increase level of CFC's)."</em>
- <u>The trapped Sun radiation inside the earth's sphere:</u>
<em>"Due to large number of CFC's inside the earths sphere, as they results in trapping the radiation which needs to be radiated back out of the earth's sphere. Causing the rise in temperature of the overall environment."</em>
Explanation:
- The chloro, floro and carbon elements which are also termed as the CFC's in general are created due increase level of industrial waste presence in the environment, leading to more solar radiation trapped inside the outer sphere of the earth's protective shield. Due, to this process the gasses are trapped inside the earth's sphere resulting in the rise in temperature.
- <u>Consequences of Climate Change:</u>
- As our earth passed from various levels and situations and as there were also some ice ages, which almost resulted in creating inhabitable situations for the living beings.
- But, these days earth is facing some alarming situations in the form of high temperature in its environment, which is some how leading to some thing more worse.
- There will be less resources of food in the near future and most importantly there will be species like polar bears and some marine animals who will face extinction due to the rise in temperature inside the environment.
