It’s because unlike twins the regular siblings aren’t born on the same date or a couple minutes apart, but rather a couple years old or younger.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
<span>The best answer to the question: "The destruction of salt marshes will directly harm each organism except" ... is Algae. Algae blooms are the biggest outcome of salt marsh destructions, which starve the water of oxygen making it uninhabitable, as the algae grows, it covers the surface of the water and harms almost every organism part of that ecosystem. So I would say algae.</span><span />
X–ray technologist diagnose images of patients by using x-rays.
Nuclear medicine technologist perform diagnostic tests of patients by giving small dose of a radioactive drug.
Submarine sonar technician operate submarine sonar, oceanographic equipment and submarine auxiliary sonar.
Nuclear Physicist Radar and Sonar technician operates and maintains highly advanced radar and sonar equipment.
Air Traffic Controller who are well organized, are quick with numeric computations and mathematics.
MRI Technologist operates MRI equipment and produce clear images of bones, organs.
Solar astronomers study the sun's systems and characteristics, such as its atmospheres, magnetic field, and storms.
<h3 /><h3>What GPS technician do ?</h3>
GPS Technician map and survey an area under the direction of a surveyor, cartographer etc
Learn more about Nuclear medicine technologist , here:
brainly.com/question/23719334
#SPJ1
No they don’t, but to be able to have cellular respiration it can perform aerobic cellular respiration. These cells will move electrons back and forth across their cell membrane. Other types of prokaryotes cannot use oxygen to perform cellular respiration, so they perform anaerobic respiration.