1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MakcuM [25]
2 years ago
13

Mendel found that yellow pea pod color (G) was dominant to green pea pod color (g), and that round seeds (W) were dominant to wr

inkled seeds (w). What percentage of each of the phenotypes below are expected from the following cross? GGww x GgWw
Yellow and round

A.
0%

B.
25%

C.
33%

D.
50%

E.
66%

F.
75%

G.
100%



-
Yellow and wrinkled


-
Green and round


-
Green and wrinkled

Biology
1 answer:
Viktor [21]2 years ago
8 0

Answer:

50% Yellow and Round

50% Yellow and Wrinkled

0% Green and Round

0% Green and Wrinkled

Explanation:

Checking both characteristics on each own we have that

<u>For pea pod colour,</u>

\begin{center}\begin{tabular}{ | c | c | c| } & G & g \\  G & GG & Gg \\   G & GG & Gg    \end{tabular}\end{center}

Since Yellow (G) is dominant over Green (g) we have that:

GG - Yellow

Gg - Yellow

100% would be Yellow

<u>For seeds format,</u>

\begin{center}\begin{tabular}{ | c | c | c| } & w & w \\  W & Ww & Ww \\   w & ww & ww    \end{tabular}\end{center}

Since Round (W) is dominant over Wrinkled (w) we have that:

Ww - Round

ww - Wrinkled

50% would be Round and 50% would be Wrinkled

You might be interested in
Why do identical twins have the same physical characteristics, whereas regular siblings are not identical?
jonny [76]
It’s because unlike twins the regular siblings aren’t born on the same date or a couple minutes apart, but rather a couple years old or younger.
8 0
3 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
The destruction of salt marshes will directly harm each organism except
soldier1979 [14.2K]
<span>The best answer to the question: "The destruction of salt marshes will directly harm each organism except" ... is Algae. Algae blooms are the biggest outcome of salt marsh destructions, which starve the water of oxygen making it uninhabitable, as the algae grows, it covers the surface of the water and harms almost every organism part of that ecosystem. So I would say algae.</span><span />
5 0
3 years ago
Ultrasound Technologist
Y_Kistochka [10]

X–ray technologist diagnose images of patients by using x-rays.

Nuclear medicine technologist perform diagnostic tests of patients by giving small dose of a radioactive drug.

Submarine sonar technician operate submarine sonar, oceanographic equipment and submarine auxiliary sonar.

Nuclear Physicist Radar and Sonar technician operates and maintains highly advanced radar and sonar equipment.

Air Traffic Controller who are well organized, are quick with numeric computations and mathematics.

MRI Technologist operates MRI equipment and  produce clear images of bones, organs.

Solar astronomers study the sun's systems and characteristics, such as its atmospheres, magnetic field, and storms.

<h3 /><h3>What GPS technician do ?</h3>

GPS Technician map and survey an area under the direction of a surveyor, cartographer etc

Learn more about Nuclear medicine technologist , here:

brainly.com/question/23719334

#SPJ1

5 0
1 year ago
Do bacteria cells have mitochondria? If yes or No justify your answer. Especially if your
Mashcka [7]
No they don’t, but to be able to have cellular respiration it can perform aerobic cellular respiration. These cells will move electrons back and forth across their cell membrane. Other types of prokaryotes cannot use oxygen to perform cellular respiration, so they perform anaerobic respiration.
8 0
2 years ago
Other questions:
  • If plants dont move why do they need energy
    8·2 answers
  • if a red blood cell has solute of concentration of 0.9%, what would be the solute concentration of an isotonic solution
    7·1 answer
  • Which of the following is an example of a population?
    8·1 answer
  • Which of the following is NOT an area where maritime tropical air masses that affect North America originate? (1 point) Gulf of
    14·2 answers
  • Which statement about heat and thermal energy is true? A. Scientists use both terms to describe how hot or cold something is. B.
    9·1 answer
  • Which of the following is not a characteristic of a mineral?
    9·1 answer
  • Diffusion occurs because of unequal concentrations of molecules. In which of the following situations will diffusion occur towar
    6·1 answer
  • HELP NEED ANSWER IN AT LEAST 5 MINUTES will mark brainliest A single cell can be an organism. O True O False​
    12·1 answer
  • What is the purpose of the mucus secreting goblet ​
    6·1 answer
  • Hi, need help with this question!<br> Thank you!
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!