1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Fittoniya [83]
2 years ago
13

Can someone please HELP?

Biology
1 answer:
serious [3.7K]2 years ago
5 0

Answer:

<h3>MAP OF THE PHILIPPINES</h3>

Explanation:

<h3>#BRAINLIESTBUNCH</h3>

You might be interested in
Note the two transcribed and translated DNA strips below. The two strips are identical except for a point mutation, where the fi
jekas [21]

Full question attached

Answer/ Explanation:

The original DNA sequence has a point mutation changing a G to a T. The resulting mRNA produced is always complementary to the DNA from which it is synthesised, so the original mRNA sequence has a T, whereas the mutated mRNA has a U. The tRNA is complementary to the mRNA, so the original has a G, and the mutated has a T.

<h3>Original DNA</h3>

GTTGGCGAATGAACGGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGCCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACGGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

<h3>_______________________________________________</h3><h3>Mutated DNA</h3>

GTTGGCGAATGAACTGAGGCTGACGTCTAAGCCTAGAAAAATTGG

RNA

CAACCGCUUACUUGUCUCCGACUGCAGAUUCGGAUCUUUUUAACC

tRNA

GUUGGCGAAUGAACTGAGGCUGACGUCUAAGCCUAGAAAAAUUGG

This is a point mutation called a substitution. This does not affect the entire sequence of the protein, because the mutation is "in frame" meaning the mRNA sequence is still read in the same way by the protein producing machinery. However, it does change the 5th codon from UGC to UGU. If we look up the genetic code, we can see that both of these codons code for cysteine, so there will be no change in the amino acid sequence of the protein

5 0
3 years ago
Which phase occurs immediately after a full moon?
Rashid [163]
Waning gibbous

youre welcome
3 0
3 years ago
Read this description of the life cycle of a mushroom. 1. A mushroom begins to grow underground as a single-celled "spore.” 2. T
olasank [31]

Answer:

youranswerisletterbbcauseThesporegrowsintomulticellularstructures calledhyphaemakesthemostsence

Explanation: :D Im Happy to help

7 0
3 years ago
Read 2 more answers
What happen to the bacteria once it reached the carrying capacity of it ecosystem
Tema [17]
It continues to multiply untill the max. later it eats itself to make more space for it to multiply
6 0
3 years ago
What is the function of DNA polymerase?
Rus_ich [418]

Answer:

Adding base pairs

Explanation:

If it help follow me on brainly please

4 0
3 years ago
Other questions:
  • 15. How is the color of blood determined?
    15·2 answers
  • Which type of cell was smaller - the onion cells or the elodea cells?
    12·1 answer
  • Which of the following statements is true?
    10·2 answers
  • A car travels 87.96 miles in 8.73 hours. what was the speed of the car
    15·1 answer
  • What must be true about the earlobes of Alice’s parents?
    8·1 answer
  • Producers, like plants, take in oxygen gas and release carbon dioxide during ____, just like animals and other living things.
    14·1 answer
  • Which of these can a wave carry from one place to another?
    14·1 answer
  • !!!!! Which of the following statements best describes the climate of an area rather than its weather conditions?
    11·1 answer
  • Where is oxygen added to the blood?
    13·1 answer
  • Original Codon: CTC GAG
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!