1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Naddika [18.5K]
2 years ago
15

The rock has a low amount of silica, is that intrusive?

Biology
1 answer:
Oxana [17]2 years ago
7 0
Answer :
Yes , it is
You might be interested in
What is the most likely reason that horses and mountain goats have hooves?
Musya8 [376]
So they can handle the tough terrain, like rocks and dirt and gravel and harsh grounds.

They way they have an advantage of actually being able to move places
<span />
4 0
3 years ago
the allele for white fur is revessive and the allele for normal fur is dominant the frequency for the normal fur allele is 0.60.
Mariulka [41]

Answer:

36% of wolves have normal fur.

Explanation:

Given , the allele for white fur is recessive and the allele for normal fur is dominant

Let "N" represents the allele for normal fur and "n" represents the fur for white fur.

As per Hardy Weinberg's principle, the frequency for dominant allele is represented by "p"

Given ,

p = 0.60\\

Then frequency for dominant genotype will be "p^2"

So, Frequency for wolves with normal fur is

p^{2} \\0.60^2\\0.36

Percentage of the wolves with normal fur is

0.36*100\\= 36%

 

6 0
3 years ago
What organism is a elephant
kirill [66]
Elephant organism => classifying Organism Good Luck! :)
7 0
3 years ago
A client whose parkinson's disease is being treated with tolcapone should concurrently take what drug?
steposvetlana [31]

Answer:

The correct answer would be levodopa/carbidopa.

Tolcapone is a drug used as an adjunct to levodopa/carbidopa combination medication.

These drugs are used to treat the symptoms of Parkinson's disease.

Tolcapone is used to inhibit enzyme COMT (catechol-O-methyl transferase).

In the brain, levodopa is converted into dopamine which helps in controlling the movement.

Carbidopa helps in preventing the breakdown of levodopa in the blood which allows more levodopa to enter the brain. In addition, it helps in reducing the side-effects associated with levodopa such as vomiting, nausea et cetera.

6 0
3 years ago
3 plz help if you can its worth 11 points+
timurjin [86]

Answer:

b

Explanation:

this is correct bc it shows that although a mutation occurred, it happened over time, and so now, the lizards attained a new adaption which allows them to avoid the floods

Hope this helps!

6 0
3 years ago
Other questions:
  • Which domains of life are classified as prokaryotes?
    13·1 answer
  • Germination
    7·1 answer
  • Often, the sampled CSF is tested for bacteria or viruses if a brain infection is suspected. Why would CSF sample from the spinal
    14·1 answer
  • Fourth stage of digestion
    15·2 answers
  • What happens during gas exchange?
    14·2 answers
  • What types of pollution do microoragnisns remove from real wastewater?
    5·1 answer
  • Describe the inner and outer cores of earth. Include information about the temperature, pressure and composition.
    8·1 answer
  • Where do cold fronts form and what type of weather is formed?
    7·1 answer
  • Which statement best describes the position of the Sun at sunrise and sunset as seen by an observer in New York State on Decembe
    14·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!