1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
timama [110]
2 years ago
12

Cancer can result from a variety of different mutational events. Which of the following is LEAST likely to result in the initiat

ion of a cancerous tumor?
A. A receptor mutation results in activation of a cell-division pathway in the absence of the appropriate ligand.
B. A mutation results in the loss of the ability to produce a tumor-suppressor protein.
C. A defect in a cell-cycle checkpoint prevents a cell from entering the S phase
D. At the anaphase checkpoint, separation of chromatids occurs without all centromeres being attached to kinetochore microtubules from both poles.
Biology
1 answer:
MrRissso [65]2 years ago
7 0

Answer: C

Explanation:A defect in a cell-cycle checkpoint prevents a cell from entering the S phase.

You might be interested in
Why is it important to pursue the use of renewable resources?
Snezhnost [94]
Renewable energy provides reliable power supplies and fuel diversification, which enhance energy security and lower risk of fuel spills while reducing the need for imported fuels. Renewable energy also helps conserve the nation's natural resources.
3 0
3 years ago
Cells can be prokaryotic or eukaryotic. Which of the following structures is present in eukaryotic cells but not in prokaryotic
Sonbull [250]

Answer:

nucleus

Explanation:

eukaryotic has a nucleus, prokaryotic does not

6 0
3 years ago
Read 2 more answers
How does carbon move from the biota to the atmosphere? view available hint(s) how does carbon move from the biota to the atmosph
aniked [119]
Carbon dioxide is released during cellular respiration.
5 0
3 years ago
Why is rna synthesis not as carefully monitored for errors as is dna synthesis?
Tems11 [23]
An error in Mrna will only affect 1 molecule of RNA of the many synthesized from a gene and do not become a permanent part of the genomic information
7 0
4 years ago
Seed packets give a recommended planting depth for the enclosed seeds. The most likely reason some seeds are to be covered with
dusya [7]

Answer:

The most likely reason some seeds are to be covered with only 1/4 inch of soil is that <u>the seeds require light to germinate.</u>

Explanation:

This seed packets does not say anyhing about temperature so we can rule out higher temperature. It is really rare to plant with seeds does not have any cotyledons and also we can't really know it from the question. Etiolation response can also be found in seedlings also from this question we can't know this for sure.

Only thing that is changes if you cover the seeds with only 1/4 inch of soil is light. If you completely cover this seed with soil it wouldn't grow.

8 0
4 years ago
Other questions:
  • I will mark you bainly. please help! :D
    14·1 answer
  • Ichthyostega is a 370-million-year-old fossil from Greenland. Ichthyostega had digits, eyes on the top of its head, and strong,
    12·1 answer
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • Your town is considering building a bridge across a large lake. Much of the town's drinking water comes from this lake. Before
    6·1 answer
  • PLEASE HELP Octopus, squid, and nautilus are examples of arthropods.
    15·1 answer
  • A 9.0 is how many times more powerful than a<br> 4.0 on the Richter scale?
    7·1 answer
  • Describe steps that can be taken to improve water quality through water conservation
    5·1 answer
  • Which body system matures during childhood?
    12·2 answers
  • What is Nuclear Fusion. ​
    5·1 answer
  • Replacement therapies for which two hormones were tested in this experiment? fsh and calcitonin estrogen and calcitonin fsh and
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!