1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
jolli1 [7]
3 years ago
15

I need help in bio it’s due tomorrow pleaseee

Biology
2 answers:
Anna35 [415]3 years ago
6 0

Answer:

1) A

2) I

3) C

4) I

Explanation: ATP is adenosine triphosphate. It has three phosphate groups attached to the 5th carbon atom of the ribose sugar. ATP contains adenine (a base), a ribose sugar and three phosphate groups.

ATP break down is an exergonic reaction in which the terminal phosphate group of ATP is cleaved to produce ADP and inorganic phosphate group (Pi) with the concomitant release of energy.

Cellular respiration involves the break down of a glucose molecules in the presence of oxygen to produce carbon dioxide, water as by-products with release of energy in form of ATP. The chemical energy in form of ATP released in cellular respiration is used to drive other cellular functions.

Passive transport is a process by which polar compounds and ions move across membrane through an alternative path created by membrane proteins. In passive transport, the transported species always move down its electrochemical gradient and does not require ATP expenditure. This means that passive transport is not coupled to ATP breakdown or does not occur at the expense of ATP hence the name passive transport. It is different from active transport which is coupled to ATP breakdown.

Ghella [55]3 years ago
4 0

Answer:

1. A

2. I

3. Sorry I am not sure.

4. I

Explanation:

1. ATP has 3 phosphate groups, T = tri aka three.

2. ATP has 3 phosphate groups and turns into ADP which as two phosphate groups because when it loses one phosphate, it releases energy.

3.

4. Passive transport does not require energy because when it passes through the cell membrane it is going with the concentration, it goes from high to low concentration. Active Transport requires energy because it is going against the concentration, low to high, so it needs energy to go from low to high concentration.

You might be interested in
A muscle cell absorbs the water it needs without using energy. Which process does the cell use to take in water?
Anna [14]

Answer:

b

Explanation:

6 0
3 years ago
If you need to prevent waves from eroding a beach, what would you do
Zielflug [23.3K]
Waves erode a beach by pressing continually against them, right? I have heard of this happening many times. What the people do is build a small trench around the outside of the beach so the waves filter down into it, then back out instead of washing up against the sand. The other thing they do is wait a couple years for the beach to go down, then they put in new sand during the winter. 

<span>Please Rate me Brainliest, I need it alot. </span>
5 0
3 years ago
Read 2 more answers
How the wildebeest are keystone species and the connection between fires , tree .?
nadezda [96]

Answer:Wildebeest are considered keystone species because their presence has myriad effects on the ecosystem, unlike those of any other species. Wildebeest are the "lawnmowers" of the Serengeti grassland. They keep grass short which in turn reduces the frequency of fires.

7 0
3 years ago
sequence 1 has a blank muation original: ATCGCCGGAATAGGCATCAGCAGT SEQUENCE 1: ATCGCCCGAATAGGCATCAGGAGT
Nonamiya [84]

Answer:

interesting

Explanation:

I love this, good job. Have a great day :))

4 0
3 years ago
How do we know that food isn't causing the population growth?
MariettaO [177]
Maybe because food was here before the population even started to grow?‍♀️
8 0
3 years ago
Other questions:
  • Compare and contrast the terms living and biotic
    7·1 answer
  • In which situations is work being done?
    14·2 answers
  • Which of the following best describes what happens when the ATP synthase
    13·2 answers
  • WILL MARK BRAINLIEZT.
    10·1 answer
  • T
    6·2 answers
  • What allows scientists to predict future climate change with some sense of accuracy?
    15·1 answer
  • Body systems interact with each other to maintain homeostasis. Which of the following is an example of interdependent body syste
    7·1 answer
  • Show working out ignore the first
    10·1 answer
  • Name three pathogens that are attacked by the immune system.
    7·1 answer
  • The map below shows the temperatures in parts of North America on an average spring day.
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!