I would say landslide because it does cause because of the lost of friction.
So it should have a similarities because the words makes sense
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
The original question has a set of choices. This is within the context of cell division. The choices are:
A. A cell in G1 of interphase and a cell in G2 of interphase
B. A cell in G1 of interphase and a cell immediately after the completion of meiosis II
C. A cell in G1 of interphase and a cell in metaphase II of meiosis
D. A cell in G2 of interphase and a cell in metaphase II of meiosis
<span>E. None of the above.
</span>
The correct answer is C. A cell in G1 is diploid and the cell in meiosis II is haploid but the amount of DNA still equivalent as each chromosome in the haploid cell consists of two chromatids. G2 cells already had been through the S phase therefore the genetic material is already doubled. A cell immediately after meiosis II has half the genetic material.