1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
2 years ago
15

Where is chlorophyll found?

Biology
2 answers:
Nesterboy [21]2 years ago
7 0

Answer:

C is your answer

Explanation:

lyudmila [28]2 years ago
6 0

Answer:

In the chloroplast.

Explanation:

Chlorophyll is a green pigment plants use to absorb light so they can make food via photosynthesis. Chloroplasts are organelles that contain chlorophyll, so it only makes sense that the best answer is the chloroplast.

You might be interested in
What can happen when earth materials overcome the force of friction holding them together?
tia_tia [17]
I would say landslide because it does cause because of the lost of friction.
7 0
3 years ago
Read 2 more answers
Everything you need is on this page! Now do a bit of unscrambling and enter the
Bond [772]
So it should have a similarities because the words makes sense
3 0
2 years ago
You are examining the phylogenic relationship of a newly discovered plant species (Species 2). You amplify the RUBISCO barcode a
frozen [14]

Answer:

a. Inversion

b. Duplication

Explanation:

Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.

In this case here,

Inversion is taking place here.

species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA

species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA

Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.

Deletion ❌❌

I am sure it's not feasible because deletion entails removal of a few sequences.

It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.

I believe duplication is feasible since AATT sequences are repeated once.

Our final answer,

inversion and duplication occur here.

4 0
3 years ago
Within a given species, which two types of cells have the equivalent amounts of dna?
kiruha [24]
The original question has a set of choices. This is within the context of cell division. The choices are:

A. A cell in G1 of interphase and a cell in G2 of interphase
B. A cell in G1 of interphase and a cell immediately after the completion of meiosis II
C. A cell in G1 of interphase and a cell in metaphase II of meiosis
D. A cell in G2 of interphase and a cell in metaphase II of meiosis
<span>E. None of the above.
</span>
The correct answer is C. A cell in G1 is diploid and the cell in meiosis II is haploid but the amount of DNA still equivalent as each chromosome in the haploid cell consists of two chromatids. G2 cells already had been through the S phase therefore the genetic material is already doubled. A cell immediately after meiosis II has half the genetic material.
6 0
3 years ago
All life must maintain an internal balance, despite environmental changes. What is this called?
stepladder [879]
This is called homeostasis.
5 0
3 years ago
Other questions:
  • what is the point on an object where the force of gravity is considered to act A. center of mass B. top of an object C. middle o
    13·1 answer
  • select all that apply. during differentiation, cells may change in _____. metabolic activity shape size color
    6·1 answer
  • Just like other magnets, the Earth has
    13·1 answer
  • Consider the food chain. What would MOST LIKELY happen if the bass started to disappear because too many of them had been caught
    5·1 answer
  • Which of the following observations best supports the conclusion that two animal species evolved from a common ancestor in recen
    12·2 answers
  • Mitosis is a part of interphase in the cell cycle. <br><br> true<br> false
    10·2 answers
  • Why do complex organisms need specialized cells?
    5·1 answer
  • In T-ball, batters hit a ball that is placed on a T-shaped stand. Batter A hits the ball by swinging the bat from a resting posi
    15·1 answer
  • Answer under 20 minutes and I will give brainiest!!
    13·1 answer
  • the text points out that studying animals may shed light on diverse aspects of human behavior. for example, research using honey
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!