<h3><u>Answer;</u></h3>
b). Activation of an upstream guanine nucleotide exchange factor
<h3><u>Explanation</u>;</h3>
- <em><u>When a ligand activates the G protein-coupled receptor, it induces a conformational change in the receptor that allows the receptor to function as a guanine nucleotide exchange factor (GEF) that exchanges GDP for GTPthus turning the G protein-coupled receptor on.</u></em>
- The activated G-protein then dissociates into an alpha (G-alpha) and a beta-gamma complex.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Answer:
5. C. 3 only (Eukaryotic)
7. A. Active Transport
Sorry I am unsure of 9.
Explanation:
Hope those help tho
A biologist would most likely concentrate on homologous features to find and analyse an evolutionary relationship between two species, finding homologous traits between species might help biologists to understand the evolution of animals, whereas concentrating on analogous features might help to compare the evolution of different species. Hope this helped!
I think its B. Im not sure
