1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
myrzilka [38]
2 years ago
6

A muscle that opposes or reverses a particular movement is a.

Biology
1 answer:
Sergeu [11.5K]2 years ago
4 0

Answer:

A muscle that opposes or reverses a particular movement is an antagonist. *When a prime mover is active, the antagonist muscles may stretch or remain relaxed.

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
A forensic scientist in using a standard biological microscope with 15 objective and 5 eyepiece to examine a hair from a crime s
SIZIF [17.4K]

The given data is Magnification, M = 15

Length of the tube , L = 16 cm

The focal length of the lens can be calculated by:

M = L/F

Substituting the value, we get:

15 = 16/f

f = 16/15

f = 1.067 cm

Using the equation of magnification we get,

M = v/u

Substituting the values we get:

15 = v/u

v = 15 u

With the help of lens formula, calculate the object distance:

1/f = 1/v + 1/u

Substituting the value we get,

1/1.067 = 1/15u + 1/u

0.937 = 1.067/u

u = 1.13 cm or 1.1 cm.

Hence, the object distance is 1.1 cm.


3 0
3 years ago
Why are common cold viruses difficult to cure?(1 point)
ss7ja [257]

Answer:

I think the answer is C

Explanation:

have a great day!

3 0
3 years ago
Read 2 more answers
Which portion of the brain is located closest to the spinal cord?
atroni [7]
<span>The brain stem is closest to the spinal cord.</span>
4 0
3 years ago
Multiple alleles _____.
just olya [345]
I'd go with A. can interact to influence a trait, such as eye color
8 0
4 years ago
Other questions:
  • A pea plant that has round seeds has the genotype Rr. It is crossed with a pea plant that has wrinkled seeds and the genotype rr
    7·1 answer
  • Which is NOT true about the discovery of new scientific evidence and theories?
    11·2 answers
  • T/F Permanent magnets can never be demagnetized.
    15·1 answer
  • A body cell is in the longest stage of its life cycle. The cell grows, synthesizing proteins and increasing in size. Eventually,
    12·1 answer
  • Describe the ways in which a polymer is affected by condensation (or dehydration) and hydrolysis reactions. Explain why phosphol
    13·1 answer
  • Describe a medical advance that has led to a decrease in the spread of communicable diseases. What is the advance? How does it p
    14·2 answers
  • People infected with the human immunodeficiency virus (HIV) have an increased risk of dying from secondary infections. Which of
    14·1 answer
  • Which of the following is an example of an
    9·1 answer
  • How to find genotype/ phenotype of parents and the ratios.
    11·1 answer
  • true or false? although cleft lip and cleft palate frequently occur together, cleft palate is repaired soon after birth and repa
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!