1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
11Alexandr11 [23.1K]
2 years ago
15

When populations approach their carrying capacity, their resources ________.

Biology
1 answer:
Elis [28]2 years ago
6 0

Answer:

the intensity of density dependent factors increase

You might be interested in
Why are glycolipids and glycoproteins important?
Vsevolod [243]

Hi! glycolipids and glycoproteins are important Because it helps to stabilise membrane structure.

6 0
2 years ago
Read 2 more answers
What makes plants green?
ikadub [295]

Answer:

Green plants are green because they contain a pigment called chlorophyll.

Explanation:

6 0
2 years ago
Read 2 more answers
Which of the following statements about reflective and refractive telescopes is not true?
evablogger [386]
It is the answer for it is d
5 0
2 years ago
I need some questions and answers about black bears.
Nesterboy [21]

Answer/Explanation:

Good simple questions are:

are black bears black? yes

what color is a lack bear nose? a black bears nose is black but the area around it is normally brown

7 0
3 years ago
You work in a laboratory that studies the molecular biology of tribbles. [Although tribbles are an alien life form, assume here
Helga [31]

Answer:

Explanation:

A) to determine amino acid sequence of the protein produced by that gene. We will use cDNA library, we will hybridize given part of DNA sequence ( as this part only contains exon part). Than we will isolate the hybridize part and translate this sequence using generic coding table.

B) for determine presence or absence of introns in gene used isolated cDNA in first question. Now we will add this cDNA to DNA library. Here cDNA due to complementary mature binds with DNA. If cDNA binds completely with gene with out looping part of gene it shows that gene is having only exons .

And if along with hybridization part some looped part present in between-- it shows both exons and intron are present.

C) for determining alternative splicing we will use cDNA library.

d) to determine length of mature mRNA which includes both the UTR and poly A sequence we will go for cDNA cloning and look for particular cDNA complementary to DNA segments. And later we isolate that cDNA and examine its whole length

E) to determine which cells in the tribble body express this particular mRNA . We use fluorescent tagged small DNA part provided. Then we will add this DNA probe to supplied tribes. The cells which are expressing , will have cDNA will bind to probe and florescent can be detected. Cells which are not expressing that gene, here probe will not bind and no fluorescence.  

F) to determine that whose blood strain is this. We will do VBTR profiling . Which VNTR profiling similar to belief stain help to determine which blood stain is this.

8 0
3 years ago
Other questions:
  • When would a testcross be done?
    15·1 answer
  • In the diagram of earths interior, which part drives movements of the plates?
    15·2 answers
  • Where would a probe with the sequence aatcg bind to a target dna with the sequence ttttagccatttacgattaatcg (recall that dna sequ
    11·1 answer
  • What was the ecosystems carrying capacity for Buffalo based on the graph once rinderpest was eliminated
    12·1 answer
  • Which of these is the most important cause of adult onset epilepsy?
    14·1 answer
  • B. Explain what happens to the energy that is not transferred from one organism to another.
    11·1 answer
  • 7. Which of the following is a physical change in matter that takes
    6·1 answer
  • How do cell differentiation and cell division work together?
    5·1 answer
  • Write the molecular formula of caustic soda using criss cross method​
    11·2 answers
  • What happens to mRNA after transcription ?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!