1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
zavuch27 [327]
3 years ago
6

Which systems interactions are dependent on the plants ability to respond to the direction of light?

Biology
1 answer:
tatyana61 [14]3 years ago
5 0

Photosynthesis and food transport has to rely on the plant to respond to the direction of the light​.

You might be interested in
A nucleotide is about to be added to a growing strand of dna. what factor determines which type of nucleotide will be added?
Triss [41]
I believe it is the nitrogen base. Adenine pairs with Thymine, and Cytosine pairs with Guanine.

:)
7 0
4 years ago
What happens when the diaphragm is pulled down (Do you inhale or exhale)?
uysha [10]

Answer:

Inhale

Explanation:

When the diaphragm is pulled downwards, it increases the volume  and decreases the air pressure within the thoracic cavity, and you inhale.

4 0
3 years ago
Increased diversity among species
REY [17]

Answer:

Strictly speaking, species diversity is the number of different species in a particular area (species richness) weighted by some measure of abundance such as number of individuals or biomass. ... An ecosystem where all the species are represented by the same number of individuals has high species evenness.

5 0
3 years ago
The basic assumption that the picture of the present can be projected into the future is the basis of a
lyudmila [28]

Answer:

Trend analysis

Explanation:

Trend analysis is a technique which is used during technical analysis in the prediction of the prices of future stocks based in the currently observed trends. The basic idea behind the trend analysis is the success or failure of a trade in future can be estimated by the conditions of the trade in past. Thus in this analysis the upward or downward growth trend of a business is used in prediction of future of business and in this way it is helpful for the investors to be sure that they should invest their money in the business or not.

4 0
3 years ago
PLEASE HELP ME<br> How can a mutation be good?<br> How can a mutation be bad?
ollegr [7]
A mutation is only good if it benefits the person and bad if it causes harm.
6 0
4 years ago
Other questions:
  • Scientists on the side of Earth opposite the epicenter of an earthquake detect mainly a. P waves. b. S waves. c. transverse wave
    11·2 answers
  • Question 22(Multiple Choice Worth 3 points)
    9·1 answer
  • Which was the dominant terrestrial life form during the mesozoic era?
    13·1 answer
  • 5’AUGAGGGCGAGCGGCGCCCACGUUUUAGGGUGA3’
    7·1 answer
  • Darwin concluded that organisms on the Galápagos Islands a. had changed over time. b. had remained the same. c. were the result
    12·2 answers
  • Which is not a property of water (1 point) A. Cohesion and adhesion B. High specific heat C. Density: greatest at 4 degrees C D.
    11·1 answer
  • Pls help pls pls pls​
    9·1 answer
  • What is missing from the co-accretion theory of lunar formation? An explanation accounting for the spherical shape of the moon.
    13·2 answers
  • In which state(s) of matter does the substance have a definite shape? give one example
    14·1 answer
  • Tại sao tóc có mầu đen
    13·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!