Answer:
Boron is the fifth element of the periodic table (Z=5), located in Group 13. It is classified as a metalloid due it its properties that reflect a combination of both metals and nonmetals. Aluminum (also called Aluminium) is the third most abundant element in the earth's crust.
The Chinese. All other cultures most like did not support astronomy.
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
Africa is the only place where giraffes live in the wild
Answer:
Explanation:
Chloroplasts are plant cell organelles that convert light energy into relatively stable chemical energy via the photosynthetic process. By doing so, they sustain life on Earth. Chloroplasts also provide diverse metabolic activities for plant cells, including the synthesis of fatty acids, membrane lipids, isoprenoids, tetrapyrroles, starch, and hormones.
