1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
MatroZZZ [7]
2 years ago
11

According to the __________ perspective, personality is primarily determined by one’s genes. a. psychodynamic b. biological c. p

sychoanalytic d. humanistic
Biology
1 answer:
Reil [10]2 years ago
3 0

The complete statement is "According to the biological perspective, personality is primarily determined by one’s genes" This is further explained below.

<h3>What are genes?</h3>

Generally, genes are simply defined as the biological fundamental unit of heredity that resides in a certain position on a chromosome.

In conclusion, biological personality is primarily determined by one’s genes.

Read more about Cells

brainly.com/question/2622341

You might be interested in
Give two examples of environments that involve more than one sphere.<br> I will give brainliest.
Soloha48 [4]
A swamp involves the biosphere and the hydrosphere

a farm involves the biosphere and the atomosphere
3 0
4 years ago
Can some one code this dna
cluponka [151]

Answer:

After replication, identical copy of the Double stranded DNA is produced. Complementary strand for each of stand given below is

Explanation:

 1. AACGTACGATCGATGCACATGCATGGCTACGC

Complementary strand  

     TTGCATGCTAGCTACGTGTACGTACCGATGCG

Protein encode: NVRSMHMHGY

2. CCCGGGTATGCATGTACGTACGTCGTATATCG

Complementary strand  

     GGGCCCATACGTACATGCATGCAGCATATAGC

Protein encode: PGYACTYVVY

3. CGCGATCGAGCGATCGACGAATGCCTAGTTTT

Complementary strand  

   GCGCTAGCTCGCTAGCTGCTTACGGATCAAAA

Protein encode: RDRAIDECLV

4. TTAAACGAGCTGCTAGCTATTTTTAAAACCCCG

Complementary strand  

   AATTTGCTCGACGATCGATAAAAATTTTGGGGC

Protein encode: LNELLAIFKTP

7 0
3 years ago
A cross between pea plants with red flowers and plants with white flowers resulted in all offspring with pink flowers. this expe
iris [78.8K]

Answer:

d: incomplete dominance

Explanation:

incomplete dominance is inheritance in which one allele for a specific trait is not completely expressed over its paired allele. this results in a third phenotype in which the physical trait is a combination of both alleles.

6 0
3 years ago
A human cell is shown in the diagram.
jolli1 [7]

Answer:

Organelle 1

Explanation:

Organelle 1 is the nucleus which stores genetic material such as the xx or xy chromosomes which contain the information for what gender a person is.

3 0
3 years ago
Read 2 more answers
Explain the process in which hormones secreted by the pancreas function with respect to increased glucose levels in the blood
KiRa [710]

Answer:

Gastrin: This hormone aids digestion by stimulating certain cells in the stomach to produce acid. Glucagon: Glucagon helps insulin maintain normal blood glucose by working in the opposite way of insulin. It stimulates your cells to release glucose, and this raises your blood glucose levels.

Explanation:

6 0
3 years ago
Other questions:
  • The tundra is characterized by extremely low temperatures as well as little precipitation, a rocky landscape,and permafrost.beca
    14·2 answers
  • Proper digestion requires the coordinated effort of many hormones with various effects. how do gastrin, cholecystokinin (cck), a
    7·1 answer
  • Feelings are often recognized by nonverbal changes, such as blushing.​ <br> a. True <br> b. False
    11·1 answer
  • Unlike sexual reproduction, vegetative reproduction 
    8·2 answers
  • Which of the following is true about the glucose molecule during the process of cellular respiration?
    14·2 answers
  • Describe two different paths a raindrop falling in the mountains might take to reach the ocean.
    7·1 answer
  • What do the following results from the TEST FOR LIFE tab indicate about the sample?
    7·1 answer
  • Que aporta la capa de nieve derretida?
    5·1 answer
  • The MOST important populations in an ecosystem are the
    15·1 answer
  • Someone please help asap.
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!