1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Artist 52 [7]
2 years ago
14

Which of the following explains how cells are regulated in their growth and reproduction?

Biology
1 answer:
choli [55]2 years ago
6 0

Answer:

cells are regulated by their oxygen uptake

You might be interested in
What would happen to a single-celled life form if the information handed down to offspring was always copied perfectly? (Select
Alja [10]

For a single-celled life form that the information handed down to offspring, we would see every generation would be a carbon copy of the one single-celled life form.This is further explained below.

To find the completion   we need to know more about a single-celled life

<h3>What would happen to a single-celled life form if the information handed down to offspring was always copied perfectly?</h3>

Generally, A single-celled organism, also known as a unicellular organism, is an organism made up of only one cell.

In conclusion, Every generation would be a carbon copy of the one before it.

Read more about Cell

brainly.com/question/2622341

7 0
2 years ago
True or False: Modifier 25 may be reported by hospital and physician (or other qualified healthcare professional) to indicate th
qwelly [4]

Answer:

True

Explanation:

In a medical procedure, it is essential to report if the patient needed an additional care or service that is more than the standard procedure or care. This is essential for all qualified healthcare providers and professionals. Based on the fact sheet in Modifier 25, the answer to the question above is true.

7 0
3 years ago
Contrast what happens to thermal energy in evaporation and condensation
Alex17521 [72]
Answer - Will try to Answer in simplest form with Reasoning. Since no one responded.

1.Solar-Thermal energy. For example the sun radiates thermal energy aka heat which then turns Liquid aka Water in gas molecules because they are escaping. (Evaporation) 

2. Condensation happens when the water molecule vapor clump together before thermal energy can be separated by it. Such as the clouds which they form tiny vapor/mist. Thats why when your on a plane and when you hit thru that cloud at hundreds of mph. Your hitting water molecules lol.
5 0
3 years ago
According to the information on the periodic table, which of the following could represent element X?
gogolik [260]

chlorine because it has 7 electrons on the outer shell

8 0
2 years ago
Which of the following is not one of the kingdoms of living things
joja [24]
Grass I think Bc it’s not a living thing
3 0
3 years ago
Other questions:
  • A biology student hiking in a forest happens upon an erect, 15-centimeter-tall plant that bears microphylls and a strobilus at i
    14·1 answer
  • The skeletons of a saber-toothed tiger and a present-day tiger are shown above. Which of the following is a structural differenc
    6·2 answers
  • Mutations in a gene occur at a rate of one nucleotide every 10 million years. The gene sequence differs by 6 nucleotides between
    7·1 answer
  • In an hiv-infected cell producing hiv virus particles, the viral glycoprotein is expressed on the plasma membrane. how do the vi
    15·1 answer
  • 3<br> What is an inference?
    12·2 answers
  • The more groups two organisms share the ___ related they are to each other.<br><br> No answers.
    9·1 answer
  • How do you determine the amount of electrons and protons?
    6·2 answers
  • If DNA code consists of only four nitrogenous bases, how can it produce so much variety among
    15·1 answer
  • Write a paragraph (7-11 sentences) explaining how chemistry affects your everyday life
    8·1 answer
  • The mRNA generated below was produced in the<br> of the cell.<br> 5' GCUACUAUGAACCUGCAAAUGAUUUCGU3'
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!