1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Tems11 [23]
2 years ago
7

The Punnett square shows the inheritance of flower color in snapdragons in the F, generation. What is the expected ratio of red

flowers to pink
flowers to white flowers in the F2 generation?

Biology
1 answer:
bija089 [108]2 years ago
7 0

Answer:

the answer will be all pink

You might be interested in
Say you had the following DNA sequence: ATGCTGCGAAACTTTGGCTGA Let's say there was a mutation that removed one letter (the first
Elden [556K]

Answer:

Codons after the mutation are not exactly the same as before mutation, because one base was deleted, changing the sequence of codons.

Codons before mutation:  ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

Explanation:

Genetic information for the aminoacids assembly during the protein synthesis is stored in short sequences of three nucleotides named codons in the DNI or mRNA. Each of the codons represents one of the 20 amino acids used to build the protein. There are a total of 64 codons. 61 codify amino acids, one of these amino acids is also the start point of protein synthesis, and the left three codons are stopping translation points.

The Sequence before mutation ATGCTGCGAAACTTTGGCTGA

Codons: ATG   CTG   CGA   AAC   TTT   GGC   TGA

The Sequence after mutation ATGTGCGAAACTTTGGCTGA

Codons: ATG   TGC   GAA   ACT   TTG   GCT

<em>Only the first one (ATG) might coincide with one of the codons before mutation. </em>

4 0
3 years ago
Which of the following best explains the difference between micro and macro evolution? A. Microevolution is based on ideas, whil
gtnhenbr [62]

Answer: C. Microevolution is small scale change to the gene pool of a population while macroevolution is larger scale changes that lead to speciation.

Explanation:

Microevolution can be defined as a small change in the gene frequency within a gene pool of the species, these changes will be inherited by the organisms and there will not be any drastic change at the species level. But in case of macroevolution the large scale change occurs at the genetic level, which retain for long. This leads to development of new organisms or results in speciation.

4 0
3 years ago
How does the cell membrane in the drawing above help to maintain the health of this cell?
Ivanshal [37]

Answer: the answer is B

Explanation:

3 0
3 years ago
German scientist carl correns found that the inheritance of variegated color on the leaves of certain plants was determined only
Anna71 [15]

The answer is extrachromosomal, or cytoplasmic, inheritance, or non-Mendelian inheritance. An example in humans is mitochondrion inheritance. Mitochondria are only passed from mother to offspring since only the egg has mitochondria while sperm does not. The name of the German scientist who discovered this type of inheritance was called Carl Correns.






6 0
2 years ago
I need help. I'm not stpid just stpid tired
Lelu [443]
Answer:
Top one is Nucleus
Middle one is DNA
Bottom mRNA
Hope this helps!
8 0
3 years ago
Other questions:
  • What is the significance of stem cells in the process of meiosis (i.e., what are they there for?)
    10·1 answer
  • ¿CÓMO FUNCIONA LA EVOLUCIÓN?
    7·1 answer
  • Everything after helium in the periodic table was made by what or who ?
    8·1 answer
  • Which hormone helps control gastric secretions and the rate of release of chyme into the small intestine?
    9·1 answer
  • Which of the following is NOT a part of ALL cells?
    12·1 answer
  • Do autotrophs do cellular respiration?
    8·2 answers
  • Human height is a trait with a very broad range of phenotypes. which patter of inheritance could account for human height? Expla
    9·1 answer
  • _The roof of artificial greenbouse<br>is made slanted, why?​
    6·1 answer
  • Change A Animal waste is acted upon by anaerobic bacteria to produce biogas change B biogas burnt as fuel which of these changes
    7·1 answer
  • WATER CYCLE &amp; IT'S COMPONENTS
    5·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!