1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Rom4ik [11]
2 years ago
14

True/False 1. A compound makes up an atom Explain

Chemistry
1 answer:
lana [24]2 years ago
5 0

Answer: True

Explanation: The answer is true because A compound is a molecule made of atoms from different elements. All compounds are molecules, but not all molecules are compounds. … There are two main types of chemical bonds that hold atoms together: covalent and ionic/electrovalent bonds. Atoms that share electrons in a chemical bond have covalent bonds.

You might be interested in
What are some<br> double replacement reactions you see every day
Cerrena [4.2K]

Answer:

  • Sodium Bicarbonate (β-3) + Vinegar
  • Lead Nitrate + Potassium iodide

Explanation:

Baking Soda and vinegar cause an explosion, in which the bicarbonate and vinegar are replaced by nitrate (∨) and oxide (Ф.) When you combine lead nitrate (Δω) with potassium iron, you also see the ingredients you combined disappear, which shall cause a replace reaction

6 0
3 years ago
1 mole of any gas is equivalent to?
iragen [17]

Answer:

22.4 L at standard temperature and pressure.

6 0
3 years ago
What is the most important simlarity between rusting and burning?
KengaRu [80]
Both are oxidation reactions.  Burning is just a lot faster than rusting.
8 0
3 years ago
A gas sample of 2.31 atm of oxygen gas and 3.75 atm of hydrogen gas that react to form water vapor. Assume the volume of the con
maxonik [38]

Mole fraction of Oxygen=0.381

Mole fraction of Oxygen= (range of moles of oxygen) ÷(general moles)

also, mole fraction of oxygen = (partial stress of oxygen) ÷ (total strain)

consequently , mole fraction of Oxygen= (2.31 atm)÷(2.31 atm + 3.75 atm)

= 0.381

The mole fraction may be calculated by means of dividing the variety of moles of 1 element of a solution by the entire quantity of moles of all the additives of a solution. It is cited that the sum of the mole fraction of all of the components inside the solution should be identical to 1.

Mole fraction is a unit of awareness. in the solution, the relative amount of solute and solvents are measured by way of the mole fraction and it's far represented through “X.” The mole fraction is the variety of moles of a selected aspect inside the answer divided by way of the entire range of moles in the given answer.

Mole fraction is the ratio between the moles of a constituent and the sum of moles of all ingredients in a mixture. Mass fraction is the ratio between the mass of a constituent and the full mass of a mixture.

The question is incomplete. Please read below to find the missing content.

Assuming that only the listed gases are present, what would the mole fraction of oxygen gas be for each of the following situations? A gas sample of 2.31 atm of oxygen gas and 3.75 atm of hydrogen gas react to form water vapor. Assume the volume of the container and the temperature inside the container does not change.

Learn more about the mole fraction here brainly.com/question/14783710

#SPJ1

4 0
2 years ago
Determine all values of hh and k for which the system has no solution
solniwko [45]
Explain more so i could answer it!!
6 0
3 years ago
Other questions:
  • What is it called when an atom has the same number of protons but a different number of neutrons?
    10·2 answers
  • Consider the reaction.
    7·2 answers
  • The heat of solution with calcium chloride is endothermic what will happen to the temperature of the container/flask when calciu
    5·2 answers
  • When the equation kclo3(s) → kcl(s) + o2(g) is balanced, the coefficient of kclo3 is _____?
    7·1 answer
  • Make a plot of arsenate species vs. pH for a 25 mM arsenate solution. Vary pH from 0-14. Neglect activity corrections. A groundw
    7·1 answer
  • Please help! Question is on the bottom​
    5·1 answer
  • What kind of energy is produced from moving water?
    15·1 answer
  • True or false.  As a wave travels through a given material its velocity changes.
    7·2 answers
  • Write the pair sequence using the right base for the mouse DNA. ATGGGTGATGTTGAAAAAGGCAAGAAGATTTTTGTTCAGAAGTGTGCCCAGTGCCACACT
    5·1 answer
  • How many atoms of iron are there in 5.00 g of iron?
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!