1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
3241004551 [841]
2 years ago
14

Which represents a negative impact of technology?

Biology
2 answers:
DiKsa [7]2 years ago
7 0

Answer:

b just took the test

Explanation:

ololo11 [35]2 years ago
6 0

Answer:

well obviously the answer is B climate change beacuase when there in an increase in technological revolution the industry will grow bigger to and so the emmsion of green house gas and other toxic that might harm the climate

You might be interested in
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
4 years ago
Mung beans planted early in the spring produce flowers at the same time as mung bean plants planted early in the summer due to t
VikaD [51]

C) amount of moisture

5 0
3 years ago
Read 2 more answers
Who is the father of genetics and what was his contribution?​
max2010maxim [7]

Answer:

The father of genectics is mendel, and he had shaped genectics as we know it today

Explanation:

6 0
3 years ago
Read 2 more answers
The electrons between atoms in metallic bonds
Step2247 [10]
B, metals, nonmentals all bond to be stable
7 0
4 years ago
Read 2 more answers
Determine which DNA technology allows for each of the following scenarios.
Ket [755]

Explanation:

A correct father is identified through the current techniques for paternity testing are using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP).

A suspect is identified using a small sample of evidence forensic DNA analysis

Forensic DNA analysis usually involves comparisons between genetic profiles extracted from biological samples collected from a specific site, object or person which is thought to be associated to a crime, in order to determine the likelihood that such samples come from a particular person

A missing person is correctly identified by

Efficient Face Recognition System for

Identifying Lost People

4 0
3 years ago
Read 2 more answers
Other questions:
  • How do you solve population growth equations
    14·1 answer
  • A recognized means of inquiry to provide scientific answers to questions is
    9·1 answer
  • Please help asap! will give brainliest
    11·2 answers
  • A cross between an individual with orange eyes and green skin and an individual with black eyes and white skin is an example of
    13·1 answer
  • What happens when the cycling of matter in ecosystems is disrupted
    5·1 answer
  • TEST Yourself
    12·1 answer
  • Calculate the gravitational potential energy of a 1,200 kg car at the top of a hill that is 42 m high.
    9·1 answer
  • The nervous system is a ___________________ in which your brain _____________ and ___________________ messages about things in a
    12·1 answer
  • What elements do all four biomolecules contain?
    7·2 answers
  • What would make it clear that a recessive trait is carried on the x chromosome in humans?
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!