1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatuchka [14]
2 years ago
14

Use the following template strand of DNA and the coding table to determine the correct amino sequence and write this sequence be

low. Disregard any modifications of mRNA that may occur.
3’ –(Promoter) T A T A T C T A C G G T C C G G C A T C G A T T T C G - 5’

Biology
1 answer:
REY [17]2 years ago
3 0

DNA and RNA have the main difference in the presence of deoxyribose sugar in DNA and ribose sugar in RNA. One more is the presence of thymine in DNA while the presence of uracil in RNA.

<h3>What is the codon?</h3>

Codon is actually a three-letter code which is a sequence of three consecutive nucleotides in a DNA or RNA molecule which generally codes for a specific amino acid.

The DNA sequence given here is:

T A T A T C T A C G G T C C G G C A T C G A T T T C G

So the RNA sequence for this will be:

A U A U A G A U G C C A G G C C G U A G C U A A A G C.

So according to the table, the amino-acid sequence will be:

Isoleucine STOP Methionine Proline Glycine Arginine Serine STOP Serine.

Generally stop codon is responsible for the termination of protein synthesis.

Thus, this was the amino acid sequence for mRNA according to the given DNA sequence.

For more details regarding codon, visit:

brainly.com/question/22991780

#SPJ1

You might be interested in
As you study two closely related predatory insect species, the two-spot and the three-spot avenger beetles, you notice that each
azamat
Character displacement
7 0
3 years ago
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Look at this image of a star cluster.
Natalka [10]

Answer:

Globular cluster

Explanation:

A globular cluster is a spherical collection of stars. Globular clusters are very tightly bound by gravity, which gives them their spherical shapes and high stellar densities toward their centers.

8 0
3 years ago
Read 2 more answers
Which of the following are financial securities that represent promises to repay a fixed amount of funds?
Mrrafil [7]

Bonds.

Guaranteeing savers high rates of return.

<h3>What is the purpose of the financial system?</h3>
  • A financial system performs the role of an intermediary and makes it easier for money to move from areas of surplus to areas of deficit. It comprises various institutions, markets, rules and laws, customs, investors, analysts, transactions, and claims and liabilities.
  • Managers can use big data in their businesses by using a financial system. A financial system combines data from numerous organizational departments into a single perspective, making it simple for users to comprehend the connections between distinct data types.
  • Financial services guarantee the advancement of both domestic and international trade. Increased domestic and international exports of goods are guaranteed by the presence of factoring and forfeiting businesses. Banking and insurance services also facilitate an increase in these promotional activities.

The following are financial securities that represent promises to repay a fixed amount of funds: Bonds.

  • Bonds provide a fixed amount of maturity value.

The following is not a service that the financial system provides for savers and borrowers: Guaranteeing savers high rates of return.

  • The financial market can't guarantee any particular rate of return to savers.

To learn more about the financial system, refer to:

brainly.com/question/13854011

#SPJ9

8 0
2 years ago
Using the diagram above, explain how a drop of water in the ocean can complete a full cycle to return to the ocean. Include how
harkovskaia [24]

Answer:

percolation evaporation condensation and precipitation

Explanation:

6 0
3 years ago
Other questions:
  • Kevin's family owns a farm. over the past few months, the farmland has shown signs of soil erosion and contamination, which resu
    15·2 answers
  • Unlike cones, rods
    7·2 answers
  • A woman who has blood type A positive has a daughter who is type O positive and a son who is type B negative. Rh positive is a t
    10·1 answer
  • How might the extinction of a species affect other species?
    9·1 answer
  • water oak trees are a source of food for termites. Black bears often look in rotting logs for insects such as termites to eat. M
    6·2 answers
  • How much is that value considered when forests are being used for their resources
    9·1 answer
  • A heritable trait that improves the ability of an individual organism to survive and to reproduce at a higher rate than other in
    12·1 answer
  • Explain what a concentration gradient is and how it is used in cellular respiration.
    11·1 answer
  • If a DNA strand has 32 % guanine, what percent thymine does it contain?
    10·1 answer
  • 3. Cardiac muscle cells make up which type of muscles?
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!