1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Dvinal [7]
2 years ago
7

WILL GIVE BRAINLIEST!!!

Biology
1 answer:
Lapatulllka [165]2 years ago
8 0

Answer:

Object A but not object B

You might be interested in
Which equation shows how matter is transformed and conserved in photosynthesis? In other words, which is the balanced chemical e
emmainna [20.7K]

Answer:

B

Explanation:

The reactants of photosynthesis are CO2 and H2O and the products are C6H12O2 and O2

the answer is not exact, but it is the closest to the actual equation

3 0
3 years ago
Which of the following is considered a mutagen? A- DNA polymerase B- red meat C- UV light D- All of the above are correct.
rusak2 [61]
The correct answer is C. UV light.
5 0
3 years ago
Name and describe all of the weather fronts.
Yakvenalex [24]

Answer:

four different types of weather fronts: cold fronts, warm fronts, stationary fronts, and occluded fronts.

a air front is a weather system that is the boundary separating two different types of air. One type of air is usually denser than the other, with different temperatures and different levels of humidity.

A cold weather front is defined as the changeover region where a cold air mass is replacing a warmer air mass. Cold weather fronts usually move from northwest to southeast. ... Warm fronts usually move from southwest to northeast and the air behind a warm front is warmer and moister than the air ahead of it.

Stationary Front - a front between warm and cold air masses that is moving very slowly or not at all.

Occluded Front - a composite of two fronts, formed as a cold front overtakes a warm

pls mark brainliest

8 0
3 years ago
Read 2 more answers
Evidence supporting E.coli DNA polymerase III having the major role in nucleotide incorporation during replication includes:
Natali [406]

Answer:

c

Explanation:

6 0
3 years ago
2. Explain how a problem with insulin receptors would affect the ability to achieve homeostasis
Akimi4 [234]
Insulin receptors regulate glucose level in blood. without that, glucose level would be uncontrolled/not normal (high/low) and it would be impossible to maintain homeostasis (stability) :P hope it will help.. :))
7 0
3 years ago
Other questions:
  • All of the following are common conflicts EXCEPT Select one: a. Character vs. self b. Character vs. character c. Character vs. n
    7·1 answer
  • As air passes over a body of water, some of the carbon stored in the water is transferred to the atmosphere. This process is cal
    7·2 answers
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • State whether the following are Tue or False
    5·2 answers
  • Would you say a leaf cell or a leaf vessel or a leaf tissue or something else?!?
    6·1 answer
  • During the action of ATP synthase, the _____ energy of the proton gradient is transformed into _____ energy of the F1 subunit, a
    8·1 answer
  • ¿Cómo crees que impacte en las generaciones futuras el genoma humano??​
    11·1 answer
  • Why is water important in the process of photosynthesis?
    6·2 answers
  • Which of the following is a nitrate?<br> A. NO3 -<br> B. NO2 -<br> C. NH3<br> D. N2
    15·1 answer
  • Raising your hand and placing it on the shoulder of a person standing in front of you, requires __________ of the shoulder.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!