1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
notsponge [240]
1 year ago
5

The US has a larger area than China, but China has a larger population. Please select the best answer from the choices provided.

T or F
Geography
1 answer:
Mkey [24]1 year ago
7 0

Answer:

The sentence is <u>TRUE</u>.

Explanation:

<em>China</em> is the most populous country in the world (<em>1.4 billion people</em>) and

<em>US</em> (334 million people).

You might be interested in
Identify the five regions that make up Canada.
pantera1 [17]
<span>The Atlantic Provinces
Central Canada
The Prairie Provinces
The West Coast
<span>The Northern Territories

I hope this helps! :)</span></span>
8 0
3 years ago
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
How much money do you ave
defon

Answer:

a lot

Explanation:

7 0
2 years ago
Read 2 more answers
When plate tectonics cause cracks to form, ________________.
Simora [160]

The answer is B.

During plate tectonics, cracks may occur in the earth crust that causes magma to rise up from the mantle. The cracks may also cause cracks to form on the crust that makes outlet channels for the magma in magma chambers. These result in volcanic eruptions on the surface of the earth that form volcanic features such as mountains.


8 0
2 years ago
Read 2 more answers
PLEASE HELP I HAVE A MIGRAINE 20 POINTS AND BRAINIEST!!!!
ivanzaharov [21]

Equality

One simply cannot pick just one religion that impacts this, because religion overall affects equality. For instance, gender and love. People discriminate on others for how they choose to percieve and identify themselves. They do this simply out of religion, or in most cases, they will use religion as an excuse to bash one another, simply because they just don't like it. But overall, people use religion as an excuse. This applies with sexual orientation. People tell us that god does not approve of same-sex couples, when in the bible it actually states that we mjst love one another, so this proves that they just simply don't like what they see, and thus in order to stop this, they need only remove themself from the situation, if they see a same-sex couple in public, simply walk away, or if it be on the internet, simply scroll away from the picture or page.

3 0
3 years ago
Other questions:
  • There are several important sources of personal income such as wages, salaries, transfer payments, personal interest, and propri
    13·1 answer
  • Government websites and archives are good places to search for
    14·1 answer
  • Which of these can be a direct and immediate result of a pyroclastic flow?
    15·2 answers
  • What's the difference between infiltration and runoff?
    10·1 answer
  • The average GDP per capita refers to?
    10·2 answers
  • Which of the following regarding the carrying capacity of the earth is FALSE?
    7·1 answer
  • Gues ty to find the answer to this.
    14·1 answer
  • The current world populationis ?
    15·1 answer
  • Question 4 OT 10
    7·1 answer
  • What is the capital of Kazakhstan?​
    9·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!