1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
sashaice [31]
2 years ago
6

What happens in meiosis during anaphase 1

Biology
1 answer:
Mama L [17]2 years ago
4 0

Answer:

In the anaphase, this is where the magical part of the process occurs. The chromosomes coil, and separate along with the centrosomes. Spindle fibers shorten and/or form, and the sister chromatids align in the equator of the cell.

You might be interested in
What Type of skeleton do Cnidarians have?<br><br> Endoskeleton, Exoskeleton, or None?
aivan3 [116]

I don't think they have one.

8 0
3 years ago
Read 2 more answers
The industrial revolution began with the exploitation of which of the following fuel sources?
mojhsa [17]

Answer:

Coal

Explanation:

Helped work become faster.

3 0
2 years ago
What is the main cause of mass wasting?
tatuchka [14]

i think the answer is a plz correct me if i'm wrong

3 0
3 years ago
Read 2 more answers
If the recessive allele for an x-linked recessive disease in humans has a frequency of 0.02 in the population, what proportion o
juin [17]

<span>To have the disease, males need only one copy of the affected X.</span>

So, the frequency of affected males will be the frequency of the disease allele = 0.02

Females must inherit two copies and be homozygotes, so the frequency of affected females will be the double of frequency of the disease allele = (0.02)

Since the ratio between female and male is 50:50 that is half of the population is male and half female

<span>Then the overall frequency of the disease will be,</span>

(0.5) (0.02) + (0.5) (0.0004) = 0.01 + 0.0002

<span>Thus, the frequency of affected individuals in this population is <span>0.0102.</span></span>

5 0
3 years ago
2
Reil [10]

Answer:

The correct answer is : sustainable use

Explanation:

  • Sustainable use: The judicious and economical use of natural resources by the present generation such that the resources can be preserved for use by the successive generations is known as the Sustainable Use of Resources.
  • Resource Selection : When a species selects a specific resource as the source of food or energy or shelter from among multiple available sources, the phenomenon is called Resource Selection.
  • Biotic preservation : The protection of biotic organisms (plants, animals, micro-organisms) by in-situ ( in the habitat of the species) or ex-situ (outside the habitat of the species) conservation in national parks, sanctuaries and biosphere reserves to prevent them from becoming endangered or extinct due to natural disaster or human intervention.
  • Biogeochemial cycling : The nutrient cycles operating on the earth, like nitrogen, carbon, oxygen, sulphur, phosphorus and water cycles, and their interaction with each other and the organisms living on earth constitute the Biogeochemical cycle.
8 0
3 years ago
Other questions:
  • In a long bone, the osteons are:
    9·1 answer
  • Which statement is true?
    6·1 answer
  • A star has a mass that is 1/5 that of earths sun. What will happen to the star as it ages? It will become a _____. A. Neutron st
    8·1 answer
  • Starting at the 5' end, how many amino acids would the sequence 5'UUAGCAAAGCUUGUGGCAUG'3 code for?​
    13·1 answer
  • Why can’t viruses maintain their own homeostasis?
    13·2 answers
  • Where is the water stored during the water cycle?
    7·2 answers
  • How does recombination contribute to offspring diversity?A. It modifies chromosomes to generate new alleles of genes that code f
    15·1 answer
  • (BRAINLIEST QUESTION) Natural selection is an important part of evolution. It is:
    5·1 answer
  • In most algae, certain fungi and higher green plant, main components of cell wall is​
    7·1 answer
  • The 14th and 15th Amendments protected African Americans' right to citizenship and the right to vote.
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!