1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
antiseptic1488 [7]
2 years ago
9

The maximum number of years a human can live is called:.

Biology
1 answer:
ivolga24 [154]2 years ago
3 0

Lifespan is an indicator that measures the average of the maximum number of years a human can live.

<h3>What is lifespan?</h3>

It is the number of years that a newborn can live according to the standard of mortality by age of the population of its country.

In other words, it is a concept that only makes sense for one generation and is obtained as part of a mortality table that refers to the average number of years that a person is expected to live after birth.

Therefore, we can conclude that lifespan is an indicator that measures the average of the maximum number of years a human can live.

Learn more about lifespan here: brainly.com/question/11445304

#SPJ1

You might be interested in
1. Which one of these is not an example of intracellular communication?
san4es73 [151]
1. A signal is translated to cause muscle contraction

7 0
3 years ago
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
what is most likely the amount of energy available at a trophic level of primary consumers if the amount of energy available to
Natali [406]
Normally a 10× drop for each trophic level, so I'd say 2,000 kilocal.
8 0
3 years ago
Read 2 more answers
The ability not to taste PTC is dependent on recessive gene (t).
yKpoI14uk [10]
Would say it would be a
3 0
3 years ago
Which phenomenon causes oceans to bulge? the blowing wind the Coriolis effect the moon’s gravity the rotation of Earth
Gelneren [198K]

The correct answer is (c) the moon' gravity

The moon's gravity causes oceans to bulge. The moon's gravitational power is responsible for the rising and falling tides.The moon affects the ocean on the sides of the planet facing and facing away from it which causes oceans to bulge away from the earth. On one side ocean bulges away from the earth as planet is being pulled towards the moon and on the other side the ocean bulges towards the moon. Bulges facing towards the moon is high tides and bulges not facing towards moon is low tides.

5 0
2 years ago
Read 2 more answers
Other questions:
  • The movement of oxygen from an area of high concentration to an area of low concentration is an example of:
    12·1 answer
  • Which life process is necessary for the survival of a species but not necessary for the survival of the individual organism?
    7·1 answer
  • I don't understand this can someone plz do an example for me
    6·1 answer
  • All hypotheses are valuable, even if they turn out not to be true. Which answer does NOT support this statement?
    7·1 answer
  • Name each of the 6 life processes, and tell why each is important?
    13·1 answer
  • Organisms that comprise the greatest mass of living substance (biomass) in a terrestrial food chain
    5·1 answer
  • Methanogens, thermophile, and halophiles are some of the most primitive life-forms found on Earth and thrive in very harsh envir
    14·1 answer
  • When do populations increase?
    10·2 answers
  • 1- Explain the following expression:<br>"reversible manner".​
    12·1 answer
  • <img src="https://tex.z-dn.net/?f=what%20%5C%3A%20is%20%5C%3A%20photosynthesis" id="TexFormula1" title="what \: is \: photosynth
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!