1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Mumz [18]
2 years ago
5

A synapse is the specific location where ____________ is functionally connected to either another neuron or ____________ . There

are two types of synapses in the human body: chemical synapses and electrical synapses. Most synapses within the nervous system are ____________ synapses.
Biology
1 answer:
Anna71 [15]2 years ago
3 0

Synapse is the connection stablished between neurons or between neurons and effector cells. a) a neuron b) effector organ c) chemical.

<h3>What is a synapse?</h3>

Neurons transmit nervous impulses.

Every neuron forms connections with other neurons or with effector organs, such as the muscle. These connections are known as synapses.

Synapses can be either chemical or electrical. The most common one is the chemical synapses that involve the release of a substance known as a neurotransmitter.

During chemical synapses, when a presynaptic neuron sends information, it releases neurotransmitters. This event is done through exocytosis.

The neurotransmitter is a molecule that travels through the synaptic space forward to the other neuron or effector cell. Once the chemical reaches the postsynaptic membrane, it binds to its receptors.

This binding neurotransmitter-receptor produces excitatory postsynaptic potential, which is the depolarization of the postsynaptic cell.

Once the action potential is initiated, it spreads to the rest of the membrane, depolarizing it.

A synapse is the specific location where _<u>a </u><u>neuron</u>_ is functionally connected to either another neuron or _<u>an </u><u>effector cell</u><u> (i.e. muscle)</u>_ . There are two types of synapses in the human body: chemical synapses and electrical synapses. Most synapses within the nervous system are __<u>chemical</u>__ synapses.

You can learn more about synapses at

brainly.com/question/27363216

brainly.com/question/8712548

brainly.com/question/14953670

brainly.com/question/12961699

You might be interested in
What event happens underwater to cause a tsunami?
Zigmanuir [339]
"Earthquake" <span>happens underwater to cause a tsunami

Hope this helps!</span>
4 0
3 years ago
Read 2 more answers
What is the effect of uneven heating of the earth's surface on the environment ​
zhannawk [14.2K]

When people speak about convection, they are usually referring to the uneven heating that occurs on the surface of the earth.

Consequences of an inconsistent heating system:

Because of the disparity in temperature distribution, certain areas of the environment are hotter than others, and there are also shifts in volume and tension as a result.

It generates updrafts, which in turn may lead to thunderstorms and other types of severe weather.

The Earth has moved slightly on its axis.

Because the sun's rays are directed directly at the equator, the temperature there is higher than in other parts of the planet.

As you approach farther north or further south of the equator, they drop down in an incline or at an angle.

Because of this, the temperature of the earth is uneven, which in turn shapes the wind and the flow of the sea and makes it possible for life to exist.

To know more about thunderstorms click on the below link:

brainly.com/question/6838263

#SPJ4

3 0
2 years ago
What is the mRNA transcript if the complementary DNA is TCTGAG?
Ghella [55]

Answer: The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)

Explanation:

3 0
2 years ago
The process by which family identity, traditions, and commitment emerge through interaction within a particular family, is an im
Vlad1618 [11]

Answer:

The correct answer is - interaction-constructionist .

Explanation:

interaction-constructionist  is the perspective that involves the the process that helps in the emerging of the family traditions, identity and commitment with the interaction within a specific family.

Example of the this perspective is the religions's proscription against birth control while using it.

Thus, the correct answer is - interaction-constructionist .

7 0
3 years ago
Which is one type of evidence that geologists usually study? location of Earth in outer space waves that move through Earth inte
Harman [31]

Answer:

  • waves that move through Earth
  • mineral composition of Earth’s layers
  • different rock samples from Earth’s surface

Explanation:

  • A geologist is interested in finding the evidence related to the study of seismic waves that move throughout the earth's interior and find out the mineral composition of different types of rocks on the surface of the earth along with the collection of different types of rock samples. A geologist is studies the structure and composition of various elements in the earth system.
8 0
4 years ago
Read 2 more answers
Other questions:
  • All organisms in an ecosystem are interrelated by the abiotic and biotic resources they use in the course of their lives.
    15·1 answer
  • What type of Symmetry does a roundworm have. <br> A bilateral <br><br> B none <br><br> C radial
    7·2 answers
  • Scientist involved in biotechnology sometimes insert DNA of one organism into a second organism. What is the purpose of this pro
    7·1 answer
  • 1) The property of matter that describes a solvent is mixing with a
    9·1 answer
  • Indicate the correct designation of the paired sex chromosomes.
    14·1 answer
  • MAPK has two different functions depending on where this kinase acts in the ____________ ____________(two words). If the kinase
    10·1 answer
  • In a photosynthesis reaction ,enzymes act to-
    5·1 answer
  • Hello(: I need some help what is an <br><br> (Allele)
    12·1 answer
  • Which of the following cellular organelles is NOT involved in making and/or
    12·1 answer
  • Plz help!!?? Due today
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!