1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Marrrta [24]
2 years ago
9

Structure in an animal cell that helps to organize cell division

Biology
1 answer:
Luden [163]2 years ago
8 0

Answer:

Centrioles are located near the nucleus and help organize cell division.

You might be interested in
C'est quoi l'hypophyse
klasskru [66]

Your ugly, no offense your weird no offense

3 0
2 years ago
Read 2 more answers
Please match these correctly
Lerok [7]
<span>1.keeps tooth alive 
</span><span>pulp
2.surface of teeth 
enamel
3.tube carrying food to stomach 
esophagus
4.last major organ in digestive system 
large intestine
5.digestive organ located above waist, close to ribs 
stomach
6.first stage of digestion takes place here 
mouth
7.regular squeezing movements 
peristatiss
8.blood vessel leading from heart 
artery
9. windpipe 
trachea</span>
6 0
2 years ago
Heat and pressure changed limestone into what metamorphic rock
Nuetrik [128]
It’s usually changes it into marble!!
4 0
3 years ago
Suppose you have one plant with the genotype TTPpYy, and another plant that is recessive for all three traits. If you were to cr
musickatia [10]

Answer:

16/64 = 1/4

Explanation:

This is a typical trihybrid cross involving three genes T, P and Y. A plant with genotype TTPpYy is crossed with a plant recessive for all traits (ttppyy).

According to Mendel's law of independent assortment, each allele for each gene will get sorted into the following 8 gametes with only 4 different: TPY, TPy, TpY, Tpy, TPY, TPy, TpY and Tpy.

The recessive parent, ttppyy will produce tpy, tpy, tpy, tpy, tpy, tpy, tpy and tpy.

Hence, using a punnet square, 64 offsprings will be produced with only 16 of them heterozygous dominant for the three traits with genotype (TtPpYy). Hence, proportion is 16/64 equivalent to 1/4.

6 0
3 years ago
A good scientifific blank can be repeated by someone else and the same results will be found
Mice21 [21]
ANSWER SOMEBODY DDFRF
6 0
1 year ago
Other questions:
  • What is a potential hypothesis
    10·1 answer
  • 50 POINTS!!! For anyone who wants to do an experiment because I got plenty of other projects to work on xD. It would be super he
    13·2 answers
  • Where in your body do you make protein cutting enzyme
    5·1 answer
  • The picture shows a natural environment. Which lists only abiotic factors in this environment? grass, tree, rock, soil bird, tur
    12·2 answers
  • what is the measure of the largest particles a stream can carry is it competence or capacity or discharge or gradient
    6·2 answers
  • What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'
    8·1 answer
  • If the nucleus of this cell has 84 chromosomes, how many chromosomes would this cell’s sperm cell have? A: 168. B: 84. C: 42. D:
    12·1 answer
  • During his lifetime A Redwood will become larger and more complex. It could be Alive because it displays which sign of life
    12·1 answer
  • A man who has cystic fibrosis married a healthy women. They produce 2 children who both have cystic fiber. What are the genotype
    12·1 answer
  • the nurse is assessing a patient who is diagnosed with respiratory acidosis. which cardiovascular finding does the nurse anticip
    11·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!