1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
8

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'

Biology
1 answer:
irga5000 [103]3 years ago
5 0

Answer:

The correct answer will be option-C.

Explanation:

The complementary base pairs are added by the rule given by the Chargaff which stated that A will bind to the T via double bond and G will bind to the C via a triple bond.

Thus the complementary sequence formed will be in the direction which is read from the 5' end to 3' end.

DNA strand-                      5' GACATACCCAGACGGTATATTGA 3'          

Complementary strand-   5' CTGTATGGGTCTGCCATATAACT 3'

Thus, option- C is the correct answer.

You might be interested in
Because water is a polar molecule, it makes an excellent solvent for polar and _________ compounds found within cells and tissue
sattari [20]
Water molecules complexis divide it by the symbiosis number and the cell tissue is broken I think. (:
3 0
3 years ago
18 POINTS
Maurinko [17]

Answer:

a animal that eats plants is a herbivore

8 0
3 years ago
Read 2 more answers
Explain what might have happened at the end of the archean to cause these orogenies to occur globally and synchronized.
Ket [755]
Trying to find the answer
3 0
3 years ago
Milk is converted to yogurt under certain conditions when the microorganisms in the milk produce acid. Which of these processes
oee [108]

Milk is converted to yogurt under certain conditions when the microorganisms in the milk produce acid. Which of these processes would you expect to be key in the production of yogurt?

a. Photosynthesis

b. Lactic acid fermentation

c. Krebs cycle

d. Alcoholic fermentation

Answer:

b. Lactic acid fermentation

Explanation:

Lactic acid fermentation occurs when pyruvate formed by glycolysis is reduced into lactate under the anaerobic conditions. The NADH serves as an electron donor for the reduction of pyruvate into lactic acid. Lactic acid bacteria are the anaerobic bacteria that ferment the milk sugar lactose into lactic acid. This converts the milk into yogurt. <em>Lactobacillus, Streptococcus salivarius</em>, etc. are mostly responsible for the conversion of milk into yogurt.

8 0
3 years ago
Please help! Question&gt;&gt;&gt;&gt;&gt;&gt; Where is aggregate generally found?
riadik2000 [5.3K]

Aggergate is usually found in:

Floodplains

Alluvial fans

Mines

6 0
3 years ago
Read 2 more answers
Other questions:
  • Is currents shape rivers over long periods of time true or false?​
    8·2 answers
  • Where was Jones assigned
    12·2 answers
  • discuss two important causes for the variation in the variation of temperature and/or salinity of an estuary.
    6·1 answer
  • Deciduous forests can only be found in North America.
    10·2 answers
  • Sensory impulses are carried to the central nervous system by
    11·1 answer
  • Why is there no ocean-continent divergence?<br> I need to know I'm just in 6th grade 
    7·1 answer
  • How has our relationship with milk changed pollution in the last 200 year
    5·2 answers
  • The water on the Earth today has been sustaining life for millions of years.
    8·2 answers
  • How do the lungs of spiders differ from human lungs?
    6·1 answer
  • So BOYS (15-16) who wants to finalize the argument... my and my friend are arguing if guys our age like T!ts or a/ss more...
    7·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!