1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
8

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'

Biology
1 answer:
irga5000 [103]3 years ago
5 0

Answer:

The correct answer will be option-C.

Explanation:

The complementary base pairs are added by the rule given by the Chargaff which stated that A will bind to the T via double bond and G will bind to the C via a triple bond.

Thus the complementary sequence formed will be in the direction which is read from the 5' end to 3' end.

DNA strand-                      5' GACATACCCAGACGGTATATTGA 3'          

Complementary strand-   5' CTGTATGGGTCTGCCATATAACT 3'

Thus, option- C is the correct answer.

You might be interested in
The spinal cord contains ascending and descending nerve fibers that send information between the cns and the periphery. This ill
Blababa [14]

The spinal cord contains ascending and descending nerve fibres that send information between the CNS and the periphery. This illustrates the conduction function of the spinal cord.

The bony components of the vertebral column serve to shield the spinal cord, which is a component of the central nervous system (CNS) and which spans from the head to the tail of the body. It is protected by the three membranes that make up the central nervous system, which are the pia mater, the arachnoid, and the dura mater.

The spinal cord contains the descending and ascending nerve fibres. The spinal cord is an important component of both the central nervous system and the peripheral nervous system. It is connected to the rest of the nervous system by a network of 31 pairs of spinal nerves, which are responsible for carrying sensory information. These nerves go up the spinal cord or through the medulla oblongata to reach the subcortical nuclei, where they form synaptic connections.

Learn more about the spinal cord here:

brainly.com/question/23916836

#SPJ4

5 0
2 years ago
When a honeybee pollinates a flower, the symbiosis would be _______
Sedaia [141]

Answer:

The relationship between them is mutualism because both organisms benefit.

Explanation:

The honey bee gains nectar from the plant while the flower is pollinated.

PLEASE MARK AS BRAINLIEST.

8 0
3 years ago
How has the burning of fossil fuels affected the global carbon cycle?
Kaylis [27]
It adds more carbon into the atmosphere
3 0
4 years ago
How are both DNA AND RNA involved un the process of proteins synthesis?
Alchen [17]

Answer:Yess they are both involved in the process of proteins synthesis.

3 0
3 years ago
The molecular view shown is best described by which state of water?
PSYCHO15rus [73]

Answer:

A . ice

Yan yung sagot ko sa test ko

7 0
3 years ago
Read 2 more answers
Other questions:
  • 2. How is a 'teeny weeny bag of marijuana" (6:58) different than "a small amount of<br>drugs"?​
    14·1 answer
  • How many chromosomes are in each of the new cell in telophase
    15·1 answer
  • when looking for Endoplasmic reticulum of a cell, the microscope zooms in enough to see ribosomes that are embedded in the outsi
    8·1 answer
  • What are genetic mutations
    11·1 answer
  • What is the difference in inheritance between boys and girls for sex linked<br> traits
    8·2 answers
  • Would you describe yourself as belonging to a specialist species or generalist species? Give reasons for your choice
    14·2 answers
  • During which prices are food molecules broken down to produce chemical potential energy in the form of ATP
    6·1 answer
  • Pepsinogen is an:A) inactive precursor to the enzyme pepsin that digests proteins in the stomach. B) active enzyme that is relea
    8·1 answer
  • When does cell division occur once
    15·1 answer
  • The temperature in earths crust decreases with depth true or false
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!