1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
8

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'

Biology
1 answer:
irga5000 [103]3 years ago
5 0

Answer:

The correct answer will be option-C.

Explanation:

The complementary base pairs are added by the rule given by the Chargaff which stated that A will bind to the T via double bond and G will bind to the C via a triple bond.

Thus the complementary sequence formed will be in the direction which is read from the 5' end to 3' end.

DNA strand-                      5' GACATACCCAGACGGTATATTGA 3'          

Complementary strand-   5' CTGTATGGGTCTGCCATATAACT 3'

Thus, option- C is the correct answer.

You might be interested in
The lining attached to the lungs is called the ___.
bearhunter [10]
The lining attached to the lungs is called the visceral pleurae.
4 0
3 years ago
The nitrogen cycle could not exist without what?
Elden [556K]
Nitrogen fixation would not occur and that would mean that there would be a lack of nitrogen and it wouldn't be able to sustain life. Since nitrogen is an essential element in every amino acid, that also means in every protein. It essential to life and without it life would mostly likely not exist.<span />
8 0
3 years ago
Select all molecules that are considered to be macromolecules. Check all that apply. An mRNA that will be translated to make a c
SOVA2 [1]

Answer:

All given options are correct.

Explanation:

Biomolecules may be defined as the organic molecules that are present in the living organism. Four important biomolecules are proteins, carbohydrates, fats and nucleic acids.

The biomolecules are known as macromolecules because they are made of large units of molecule. The mRNA that translates to form a enzymes is macromolecule because RNA is made of large units of nucleotides. Lipid that found in cell membrane are macromolecules because they are made of more than 1000 atoms. Protein that are involved in DNA replication are macromolecules as they have large units of amino acids.

Thus, all the given option are correct.

4 0
3 years ago
Which best describes a protein?
ad-work [718]

Answer:

C. A chain of amino acids

Explanation:

Proteins are made up of hundreds or thousands of smaller units called amino acids, which are attached to one another in long chains. There are 20 different types of amino acids that can be combined to make a protein. ... These proteins bind and carry atoms and small molecules within cells and throughout the body.

6 0
3 years ago
Choose all characteristics of prostaglandins.
krek1111 [17]

Prostaglandins are not stored in cells and are synthesized just before they are released, rapidly inactivated after their release and they are paracrine substances (Options b, c and e).

<h3>Whta are prostaglandins?</h3>

Prostaglandins are chemical substances that act as hormones by affecting surrounding cells in a tissue.

These substances (prostaglandins) are not secreted by specific glandular organs as other hormones.

Prostaglandins are substances that have fundamental functions for the normal functioning of the body.

Learn more about prostaglandins here:

brainly.com/question/8213520

8 0
2 years ago
Other questions:
  • Which statements below is NOT TRUE based upon the information in the phylogenetic tree?
    9·1 answer
  • When a muscle is stimulated to contract aerobically, less lactic acid is formed than when it contracts anaerobically because:___
    5·1 answer
  • The classification of species is what
    12·1 answer
  • ANSWER PLS: WILL GIVE BRAINLIEST
    14·1 answer
  • Which condition need to be in balance for cells to function
    14·1 answer
  • Bees and butterflies have a mutualistic relationship with flowering plants. Which statement describes this mutualism? *
    8·1 answer
  • Preexisting rock that is subsequently altered to form a metamorphic rock is termed a ________.
    5·1 answer
  • Mention two advantages of the extensive network of endoplasmic reticulum ​
    8·1 answer
  • Please answer! Biology stuff...
    15·1 answer
  • Thế giới sinh vật được phân chia thành những nhóm gì
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!