1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
8

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'

Biology
1 answer:
irga5000 [103]3 years ago
5 0

Answer:

The correct answer will be option-C.

Explanation:

The complementary base pairs are added by the rule given by the Chargaff which stated that A will bind to the T via double bond and G will bind to the C via a triple bond.

Thus the complementary sequence formed will be in the direction which is read from the 5' end to 3' end.

DNA strand-                      5' GACATACCCAGACGGTATATTGA 3'          

Complementary strand-   5' CTGTATGGGTCTGCCATATAACT 3'

Thus, option- C is the correct answer.

You might be interested in
What is organic food? please elaborate
xz_007 [3.2K]
Organic food is the product of a farming system which avoids the use of man made fertilizers,pesticides;growth regulators and livestock feed additives. 

In other words, It's a pure food
6 0
3 years ago
An ecosystem undergoing forest succession would likely start out with which of these types of plants?
muminat

Answer:

moss

Explanation:

An ecosystem undergoing forest succession would likely start out with moss.

7 0
3 years ago
Principal cambio químico explicado por lavoisier
ozzi

Main chemical Change explained by Lavoisier

6 0
3 years ago
The offspring {blank} reproduction are more likely to survive changes in the environment.
geniusboy [140]

Answer:

sexual

Explanation:

there are two types of reproduction,

the boring kind and the fun kind

Uh i mean asexual and sexual

in asexual the DNA is copied pretty much exactly the same so there is no room for improvement so if something suddenly changes the organism dies.

In sexual, The DNA of 2 different organisms are combined and this allows for greater variation in genetic evolution. so if something in the environment happens, the ones with a better genes will survive and reproduce more while the other ones die.

8 0
3 years ago
ASAP!!
never [62]

Answer:

37oC - temperature

It is important that the temperature is controlled because it maintains consistency and safety.

Explanation:

-Temperature is a common type of controlled variable.

-A control variable is anything that is held constant or limited in a research study

6 0
1 year ago
Other questions:
  • If an organism has six pairs of chromosomes, how many different gametes can be produced?
    10·1 answer
  • Explain why Aristotle's system of classifying animals is no longer used by biologists?
    6·1 answer
  • Suppose that gene (b) is sex-linked, recessive, and lethal. A man and a woman who is heterozygous for this gene have many childr
    8·1 answer
  • Earth is tilted 23.5 degrees on its axis. The direction of Earth’s tilt does not change as it orbits the sun. What conclusion ca
    6·2 answers
  • Pls help me. i need to get this right or i will fail
    5·1 answer
  • A neap tide is when the tides have a big difference between high and low tide. *
    12·1 answer
  • a heavily populated town with a housing shortage is located near one large river the water in the river is not heavily polluted
    5·1 answer
  • In a mendelian trait: when the genotype has one dominant allele and one recessive allele, the phenotype will be like the blank a
    7·1 answer
  • Which populations have the smallest number of organisms
    8·1 answer
  • WILL MARK BRAINLIEST!
    6·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!