1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
8

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'

Biology
1 answer:
irga5000 [103]3 years ago
5 0

Answer:

The correct answer will be option-C.

Explanation:

The complementary base pairs are added by the rule given by the Chargaff which stated that A will bind to the T via double bond and G will bind to the C via a triple bond.

Thus the complementary sequence formed will be in the direction which is read from the 5' end to 3' end.

DNA strand-                      5' GACATACCCAGACGGTATATTGA 3'          

Complementary strand-   5' CTGTATGGGTCTGCCATATAACT 3'

Thus, option- C is the correct answer.

You might be interested in
Which is associated with low humidity?
yanalaym [24]
Dry air might be the answer but honestly I’m not sure if it is
5 0
3 years ago
Read 2 more answers
___________ claims are initiated by the parent and/or child based on the harm suffered as a result of being born.
aleksley [76]

Answer:

Wrongful life

Explanation:

Wrongful life is the term used for the claim initiated by the parent based on the harm or injury brought upon a child at birth either due to negligence of the health caregiver or health facilities

4 0
3 years ago
How does the following sentence contribute to the development of the main idea in the article?
rosijanka [135]

Answer:

B

Explanation:

....................

7 0
3 years ago
When an enzyme is denatured, what happens to the enzyme?
nignag [31]
Change the pH and the enzyme<span> stops working. Increasing the temperature to 60°C will cause a permanent change to the shape of the active site. This is why </span>enzymes<span> stop working when they are heated. We say they have become </span>denatured<span>.</span>
7 0
3 years ago
Read 2 more answers
Living Things That cannot Make There own food are called what
saveliy_v [14]
They are called Consumers I believe hope that helps ☺
8 0
2 years ago
Read 2 more answers
Other questions:
  • In the case of cancer, uncontrolled cell division is a problem because it. . lowers t-cell and lymphocyte production. . requires
    14·2 answers
  • A carbon ring structure that contains one or more atoms of nitrogen
    7·1 answer
  • which statement best describes science? a. science can answer only math b. Science can answer all the questions c. science canno
    5·1 answer
  • Which of the statements would BEST serve as a topic sentence for a paragraph?
    12·2 answers
  • Primary cellular sites for synthesis of proteins
    9·2 answers
  • Will mark brainliest and give 15 points if you give explanation to the answer you give
    8·1 answer
  • Where is carbon NOT found
    15·2 answers
  • Please help me ASAP this is very important please help!!!!!
    8·1 answer
  • What is the density of a mineral used for?
    6·1 answer
  • Identify the stages of the water cycle where water moves downward from the force of gravity.
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!