1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
8

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'

Biology
1 answer:
irga5000 [103]3 years ago
5 0

Answer:

The correct answer will be option-C.

Explanation:

The complementary base pairs are added by the rule given by the Chargaff which stated that A will bind to the T via double bond and G will bind to the C via a triple bond.

Thus the complementary sequence formed will be in the direction which is read from the 5' end to 3' end.

DNA strand-                      5' GACATACCCAGACGGTATATTGA 3'          

Complementary strand-   5' CTGTATGGGTCTGCCATATAACT 3'

Thus, option- C is the correct answer.

You might be interested in
two students are discussing natural selection in bacteria and how it can relate to antibiotic resistance in bacteria
shutvik [7]

Answer:

yes

Explanation:

some the bacteria are resistance to antibiotics due to mutation.

4 0
3 years ago
What is the Hepatic Portal Vein?​
belka [17]

Answer: The hepatic portal vein is one of the most important vein that receives blood from the body and transports it into the liver for filtration and processing. This vein is part of the hepatic portal system that receives all of the blood draining from the abdominal digestive tract, as well as from the pancreas, gallbladder, and spleen.

‘Hepatic’ means of or relating to the liver, therefore the hepatic portal vein is a blood vessel that sends nutrient-rich blood from the gastrointestinal tract and spleen to the liver, but also delivers toxins to the liver that will be chemically modified in the proces of detoxication

8 0
3 years ago
Read 2 more answers
What is the naming system developed by Carolus Linnaeus?
Umnica [9.8K]

Answer: binomial nomenclature​

4 0
3 years ago
Read 2 more answers
Which of the following has mechanical energy?
marshall27 [118]
D. Visible light . Is the correct answer I hope this helps:)
4 0
2 years ago
Read 2 more answers
Which layer is between the asthenosphere and the outer core?
masya89 [10]

the lithosphere is inbetween

4 0
3 years ago
Read 2 more answers
Other questions:
  • Where does the energy for active transport come from ?
    12·1 answer
  • A very small tilt in Earth’s axis would likely cause
    15·1 answer
  • Who used a compound microscope to see chambers within cork amd named them cells
    12·2 answers
  • 5. The major functions of carbohydrates irſclude
    11·1 answer
  • What is the correct amino acid sequence for the given DNA sequence? TACACGTTCACC
    6·1 answer
  • Native people in the Amazon rainforest use a toxin to help them catfish the toxin interferes with the gas exchange in the fish w
    9·1 answer
  • A researcher speculates that an enzyme has the following energy profile and that it is a reasonable profile given what we know a
    12·1 answer
  • How do astronomers know the universe is expanding?
    7·1 answer
  • Which would most affect the health of fish in a Local pond
    6·1 answer
  • How would you explain Darwin's mechanism for evolution called "natural selection"?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!