1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
8

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'

Biology
1 answer:
irga5000 [103]3 years ago
5 0

Answer:

The correct answer will be option-C.

Explanation:

The complementary base pairs are added by the rule given by the Chargaff which stated that A will bind to the T via double bond and G will bind to the C via a triple bond.

Thus the complementary sequence formed will be in the direction which is read from the 5' end to 3' end.

DNA strand-                      5' GACATACCCAGACGGTATATTGA 3'          

Complementary strand-   5' CTGTATGGGTCTGCCATATAACT 3'

Thus, option- C is the correct answer.

You might be interested in
What type of graph is used here to represent the growth of tortoise shells?
NISA [10]
That right there is a line graph
4 0
3 years ago
If tips of grasses or sugar cane are removed they keep growing in length
Nikitich [7]

Answer:

Presence of intercalary metristems.

Explanation:

Makes the sugar cane grow in length even if the tips are removed.

7 0
3 years ago
What is the most likely effect that a war might have a food security?
ollegr [7]
<span>What is the most likely effect that a war might have a food security? 

A. Crops would be burned and convoys attacked to deny food sources to the enemy

During war time, everything is done to ensure victory. Food and water of the enemies are either confiscated or burned down. Enemies will be starving and dehydrated making them susceptible to sickness or death. Decreasing there numbers and making it easier to defeat them in battle. </span>
4 0
3 years ago
In two or more sentences, explain how DNA replicates, including what percentage of the replicated strand is new vs. old.
k0ka [10]

Answer:

DNA replication is the process by which DNA makes a copy of itself during cell division

1 by unzipping the double helicase or the double helix structure of the molecule

2. the separation of two single strand of DNA

The percentage of the replicated strands of the new to the old is 50-50

6 0
3 years ago
Last week, you looked at both animal &amp; plant cells. Both of these cells were ______. This week, you'll be looking at a diffe
Inga [223]

Answer:

"Last week, you looked at both animal & plant cells. Both of these cells were diploid somatic eukaryotic. This week, you'll be looking at a different, but very important, type of cell: sexual cells. Two gametes, one from a female & one from a male, merge during the process of fecundation/fertilization to form a zygote. All in the organism will develop from this initial diploid cell".

Explanation:  

There are two principal types of cells in the organism: Somatic cells that can not form any gametes, and germ cells that are in charge of gamete production. Both somatic cells and germinal cells will end their cycle dividing and becoming two daughter cells with the same genetic dotation after mitosis.

Somatic cells are any cell in the body excepting from sperm and egg cells. These somatic cells are diploid, they contain two chromosomes sets, each one inherited from each parental. Mutations in somatic cells affect the individual but the progeny does not inherit them. In this sense, these cells do not contribute to anything to inheritance terms through genetics.

Germ cells are the reproductive diploid cells, and the sexual organs (testes and ovaries) are the ones that produce them. These cells might suffer mitosis to form more sexual cells, and then a few of them suffer meiosis giving place to haploid gametes called sperm and egg cells through the gametogenesis process. Each germ cell produces 4 haploid gametes after meiosis.  

Gametes´destiny is to merge in the process of fecundation, during which a new diploid cell called zygote emerges through fertilization. The zygote is a complete cell from the structural point of view that suffer successive mitosis to form the new organism.

 

6 0
3 years ago
Other questions:
  • If a SNARE protein is an acronym, what does it stand for?
    15·1 answer
  • Which of the following is a substance that is found between the cell membrane and the nucleus, which primarily consists of water
    7·1 answer
  • What is the difference between a muscular strength exercise and a muscular endurance exercise?
    11·1 answer
  • What is the answer to 5 1×10 ??
    8·1 answer
  • I don’t understand it’s confusing like I don’t like science and don’t know what to do can u help me plz
    8·1 answer
  • Which of the following statements describes and interaction between the atmosphere and the biosphere?
    12·1 answer
  • What route does oxygen take as it enters the body?
    12·2 answers
  • What can scientists observe over long periods of time to determine the patterns in climate change?
    13·1 answer
  • 1. Get a flashlight and switch it on.
    14·1 answer
  • Why is the media we use to grow bacteria get damaged?​
    6·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!