1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
8

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'

Biology
1 answer:
irga5000 [103]3 years ago
5 0

Answer:

The correct answer will be option-C.

Explanation:

The complementary base pairs are added by the rule given by the Chargaff which stated that A will bind to the T via double bond and G will bind to the C via a triple bond.

Thus the complementary sequence formed will be in the direction which is read from the 5' end to 3' end.

DNA strand-                      5' GACATACCCAGACGGTATATTGA 3'          

Complementary strand-   5' CTGTATGGGTCTGCCATATAACT 3'

Thus, option- C is the correct answer.

You might be interested in
PLZZ HELPPPPP ASAPPP!!!<br><br> !!!!30 points !!!!
yaroslaw [1]

Using two heterozygous tall pea plants, so Tt is the genotype.

       T        t    <---- alleles from parent one

T      TT    Tt

t       Tt      tt

^alleles from parent two on the left

Results:  TT, Tt, Tt, and tt

Genotype ratio:  1/4 TT, 1/2 Tt, 1/4 tt

Phenotype ratio: T is dominant over t, so 3/4 tall and 1/4 short pea plants

8 0
3 years ago
_____ cells form the body's skin, inner linings, and glands.
olasank [31]
A. epithelial cells form from the body's skin
5 0
3 years ago
Read 2 more answers
Is influenza aerobic or anaerobic?
Pavlova-9 [17]

Answer:

aerobic

Explanation:

3 0
3 years ago
Parent rock that contains large amounts of quartz, such as granite, will weather to form?
GaryK [48]
Sandy soil is the parent rock that contails large amounts of quartz!!
8 0
3 years ago
Read 2 more answers
In a motor reflex , such as the patellar tendon reflex, afferent action back to the spinal cord is mediated through which of the
brilliants [131]

Answer:

The correct answer will be option-B.

Explanation:

The patellar tendon reflex is the kicking movement of the lower leg in response to the tap on patellar cap used to test the L2, L3, and L4 segments of the spinal cord in the body.

The spinal cord interacts with muscles through muscle sensors called muscle spindle which signals after the stretching of the muscle. The signals are sent to the spinal cord through afferent neurons or sensory neurons which starts the reflex action to prevent overstretching of the muscle.

Thus, Option-B is the correct answer.

7 0
3 years ago
Other questions:
  • Https://www.usatestprep.com/modules/video/video_player.php?testid=558&amp;assignment_id=28022452&amp;strand=2930&amp;element=191
    12·2 answers
  • What is the energy associated with the creation of a molecule?
    8·1 answer
  • What is a cell made of?
    7·1 answer
  • In his study of pea plants, Gregor Mendel used which method to produce offspring?
    11·1 answer
  • A part of an mRNA has the sequence GGA. Which change to the sequence would indicate a missense mutation
    5·2 answers
  • A symbiotic relationship in which one species benefits and the other is harmed is known as
    6·1 answer
  • What are at least four different populations of organism that live in your ecosystem?
    8·1 answer
  • DNA is double stranded helix, connected by what could be described as "ladder rungs". These rungs are actually nucleotides, the
    6·2 answers
  • Name two substances<br>that are made when glucose reacts with oxygen inside a cells​​​​​​​​​​​​
    13·2 answers
  • Describe the hypotesis of continental drinft
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!