1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
8

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'

Biology
1 answer:
irga5000 [103]3 years ago
5 0

Answer:

The correct answer will be option-C.

Explanation:

The complementary base pairs are added by the rule given by the Chargaff which stated that A will bind to the T via double bond and G will bind to the C via a triple bond.

Thus the complementary sequence formed will be in the direction which is read from the 5' end to 3' end.

DNA strand-                      5' GACATACCCAGACGGTATATTGA 3'          

Complementary strand-   5' CTGTATGGGTCTGCCATATAACT 3'

Thus, option- C is the correct answer.

You might be interested in
What are the causes of Sediment Pollution and what are the consequences? and describe what it is
Troyanec [42]

Sediment pollution is the single most common source of pollution in U.S. waters. Approximately 30% is caused by natural erosion, and the remaining 70% is caused by human activity. ... Sediment pollution can have long-term impacts on aquatic insects, fish and other wildlife in affected waterways

3 0
3 years ago
List 5 examples of matter and five examples that are not matter. Explain your answers.
horsena [70]
Matter: Gases,plasma,melting &freezing, solids, vapor
Not Matter: time,sound,sunlight,heat,gravity
6 0
3 years ago
Read 2 more answers
Wendy measures the temperature outside of her school every ten minutes. She records her data in the table below. Time Temperatur
AlladinOne [14]

Answer:

b

Explanation:

the rain is likely in the in the next few minutes

3 0
3 years ago
How can natural selection account for the long tongues of butterflies?
rusak2 [61]

Answer:

Because butterflies with longer tongues were better equipped to eat nectar from inside flowers, and so it was easier for them to eat and grow. So they were better quipped to survive than those with shorter tongues.

8 0
3 years ago
You are talking with a classmate about modeling electromagnetic waves. You suggest using a spring toy, such as a Slinkie. Your c
Olin [163]

Answer:Use a stretched Slinky to model sound waves moving through a material.When you squeeze the Slinky's coils together at one end (compression), this causes the coils in front of them to spread out (expansion). When the squeezed coils are released they spread out and squeeze the coils in front of them together. The squeezed coils in turn move forward, pushing on the coils in front of them and so on.

Squeezing the end coils gave them energy that was transferred from one end of the slinky to the other. As the energy goes through the Slinky, all the coils do not move at once, some of the coils are crowded together and some are spread apart.

6 0
3 years ago
Other questions:
  • A physiological ________ is a difference in chemical concentration, electrical charge, physical pressure, temperature, or other
    12·1 answer
  • Who described atoms as having a positive nucleus with electrons that have different energies at different energies at different
    9·1 answer
  • The XX and XY sex chromosome shape is common to both
    9·2 answers
  • Which statement below best describes how biodiversity contributes to the sustainability of an ecosystem?
    7·1 answer
  • Alike between pathogens and antibodies
    8·1 answer
  • A technique psychologists use to measure electrical activity in the brain is
    13·1 answer
  • Which of the following best describes aerobic respiration?
    5·1 answer
  • What does DNA stand for
    15·2 answers
  • Bees in a colony are assigned different jobs. As they develop, workers begin to look dramatically different. (environmental or g
    15·1 answer
  • In the condensation part of the water cycle, what is the change of state that water goes through?
    12·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!