1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
8

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'

Biology
1 answer:
irga5000 [103]3 years ago
5 0

Answer:

The correct answer will be option-C.

Explanation:

The complementary base pairs are added by the rule given by the Chargaff which stated that A will bind to the T via double bond and G will bind to the C via a triple bond.

Thus the complementary sequence formed will be in the direction which is read from the 5' end to 3' end.

DNA strand-                      5' GACATACCCAGACGGTATATTGA 3'          

Complementary strand-   5' CTGTATGGGTCTGCCATATAACT 3'

Thus, option- C is the correct answer.

You might be interested in
What do you think would happen to a cell if enzymes were not<br> present?
ohaa [14]

Answer:

They would not be able to achieve homeostasis.

Explanation:

Homeostasis refers to the maintenance of a stable internal environment and the cell needs a healthy and proper enzymes to do this.

7 0
3 years ago
Read 2 more answers
I WILL GIVE BRAINLIEST! This is for 9th Grade Honors Biology... You need to place the words from the word bank in the correct or
Lera25 [3.4K]

Traits included physical features such as flower color. Today, these factors are called <u>alleles</u>.  Mendel developed the hypothesis that some factors could be dominant, while others were <u>recessive</u>. According to his theory, a dominant factor is expressed when <u>only one factor is presen</u>t in the offspring. On the other hand, a <u>recessive</u> factor expresses its <u>phenotype</u> when <u>both factors are present</u> in the offspring. Today, the term<u> genotype </u>refers to the combination of factors possessed by an organism.

  1. alleles
  2. recessive
  3. only one factor is present  
  4. recessive
  5. phenotype
  6. both factors are present  
  7. genotype

7 0
3 years ago
Organisms classified as fungi have unique characteristics. Which of the following characteristics is found only in organisms cla
Tema [17]

Answer:

C

Explanation:

5 0
3 years ago
Read 2 more answers
The energy required for photosynthesis is provided by
konstantin123 [22]

sunlight..........................

4 0
3 years ago
Read 2 more answers
Joe denied being the father of Lisa. Lisa's mom took Joe to court to prove he is Lisa's biological father. The way to prove this
expeople1 [14]
The correct answer would be DNA Profiling. When Joe denied being the father of Lisa, Lisa's mom took Joe to the court to prove that he was Lisa's biological father. One way of proving that he's truly the biological father is by undergoing both DNA's into DNA profiling.
8 0
3 years ago
Read 2 more answers
Other questions:
  • Nucleic acids are composed of monomers called?
    11·1 answer
  • Which of these events breaks down rocks into smaller pieces? (4 points) Sedimentation Deposition Weathering Erosion​
    12·1 answer
  • Which of the following best explains how genetic recombination influences evolution?
    15·1 answer
  • Answerrrrrrrrrrrrrrrrerrrr
    6·1 answer
  • Answer ASAP please
    13·1 answer
  • Which type of metamorphic rock forms when limestone is exposed to heat and pressure?
    14·2 answers
  • Below is a mature eukaryotic mRNA transcript. Translate this mRNA into a protein, also showing the tRNA anticodons involved. Mak
    7·1 answer
  • Lab report exercise and homeostasis
    10·1 answer
  • 2. In 1988 several large forest fires occurred in
    11·1 answer
  • What is a dinosaur that still lives among us today? readworks answers
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!