Question

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'

Answer 1

Answer:

The correct answer will be option-C.

Explanation:

The complementary base pairs are added by the rule given by the Chargaff which stated that A will bind to the T via double bond and G will bind to the C via a triple bond.

Thus the complementary sequence formed will be in the direction which is read from the 5' end to 3' end.

DNA strand-                      5' GACATACCCAGACGGTATATTGA 3'          

Complementary strand-   5' CTGTATGGGTCTGCCATATAACT 3'

Thus, option- C is the correct answer.