1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Stolb23 [73]
3 years ago
8

What would be the complementary strand for the following DNA sequence 5' GACATACCCAGACGGTATATTGA 3'

Biology
1 answer:
irga5000 [103]3 years ago
5 0

Answer:

The correct answer will be option-C.

Explanation:

The complementary base pairs are added by the rule given by the Chargaff which stated that A will bind to the T via double bond and G will bind to the C via a triple bond.

Thus the complementary sequence formed will be in the direction which is read from the 5' end to 3' end.

DNA strand-                      5' GACATACCCAGACGGTATATTGA 3'          

Complementary strand-   5' CTGTATGGGTCTGCCATATAACT 3'

Thus, option- C is the correct answer.

You might be interested in
A substance with a pH of 3 is how many more times acidic than a substance with a pH of 5?
rodikova [14]
It’s 100x more acidic than 5
7 0
3 years ago
Question 1 (1 point) Which of the following is NOT one of the four main elements of an amino acid? Question 1 options: Nitrogen
Irina18 [472]

Answer:

calcium is not a main element of calcium . question 2 hemoglobin is a globular protein with an embedded heme group. so a transportation protein and question 3 the building blocks of proteins are amino acids.

Explanation:

4 0
3 years ago
People with diabetes often receive insulin injections. What effect does insulin have on the body
Black_prince [1.1K]
Insulin lowers blood sugar from the body so that yôu don't get sick
5 0
3 years ago
The face of the moon is only partially visible during which phase?
MariettaO [177]

Answer:

Waxing crescent and first quarter

Explanation:

A waxing crescent moon is when the Moon looks like crescent and the crescent increases ("waxes") in size from one day to the next. This phase is usually only seen in the west. The first quarter moon (or a half moon) is when half of the lit portion of the Moon is visible after the waxing crescent phase.

4 0
3 years ago
Which therapeutic cloning application is most likely a benefit to society
FinnZ [79.3K]
<span>Therapeutic cloning means that it could be used to heal people so the best way to benefit the society while doing this would be to help cure diseases. Example would be cloning body parts and testing diseases on them and then developing medication that can help against them. Also you could clone exact body parts that fit you so you could have a new kidney or lungs if necessary that fit you perfectly.</span>
6 0
3 years ago
Other questions:
  • Which statement about the burden of childhood illness in the under-5 age group is true?
    15·1 answer
  • Air pollution only occurs as a result of human activity
    11·2 answers
  • Please answer the picture. Thanks
    8·1 answer
  • A piece of paper is cut into small pieces which physical property do the small pieces have in common with a regular sheet of pap
    5·1 answer
  • What role does skin play in the excretory system?
    14·1 answer
  • What structure is formed during the unwinding process of replication?
    15·2 answers
  • 1. Which of the following lists structures from smallest to largest?
    14·2 answers
  • Please answer this for me
    10·1 answer
  • Hello, plz answer
    14·1 answer
  • Which is an a word that shows the outlet isn't completely sure about a particular statement
    12·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!