1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Sedaia [141]
2 years ago
8

Who Is The Lady Massiah

Law
1 answer:
ad-work [718]2 years ago
7 0

Answer:

lady massiah

Explanation:

Ministries Entrepreneurship/Entrepreneurial  

Ministries Entrepreneurship/Entrepreneurial Studies at Detroit Entrepreneurship Institute

Wayne County Community College District

Detroit, Michigan, United States

You might be interested in
What are your perspectives on the death penalty?
Illusion [34]

Answer:

hate it

Explanation:

no one  deserves to die because that penalty goes against  human decency

3 0
3 years ago
Read 2 more answers
What does the bar exam consist of?
Elodia [21]
The UBE consists of three parts: the Multistate Bar Examination (MBE), the Multistate Essay Examination (MEE), and the Multistate Performance Test (MPT).
8 0
3 years ago
HELP ME! HELP ME!!!! According to the Bureau of Labor Statistics, what is the average salary of a homicide detective?
mash [69]

Answer:

All wrong.

Explanation:

their salary is at least $79,970

5 0
3 years ago
Arielclairfl <br> Can we be friends?
quester [9]

Answer:

hi if they dont can i be?

Explanation:

7 0
3 years ago
Sleazeco, Inc. employee Harold Hapless died after several weeks of exposure to certain toxic chemical fumes at the Sleazeco plan
lozanna [386]

Answer and explanation:

After carefully reading the situation presented in this statement, it is correct to say that the accurate resolution would be that Sleazeco may be held criminally liable for the acts of the president and the plant manager if they were acting within the scope of their employment and for the benefit of the corporation.

5 0
4 years ago
Other questions:
  • You are the Human Resources Director at a large manufacturing plant. Due to a significant increase in supplier costs, the plant
    10·1 answer
  • When someone is accused of a crime does he have the burden to prove his innocence
    15·2 answers
  • Question 7
    15·2 answers
  • How many repeats are there for this STR? Refer to the following DNA sequence to answer the questions: CTAGAAGCTTAAAGCTTCATCATCAT
    15·1 answer
  • What is an illegal absence
    5·1 answer
  • In two or three sentences, explain why our understanding of rights changes over time.
    8·2 answers
  • 1.
    9·2 answers
  • • J20P13Q3 Explain how the system of precedent
    15·1 answer
  • The impeachment process is a check on the president by what branch of government?
    7·1 answer
  • Part of an investigator’s job is to look for and collect physical evidence at crime scenes.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!