1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Crazy boy [7]
3 years ago
15

Uppose you are a research assistant in a lab studying dna- binding proteins. you have been given the amino acid se- quences of a

ll the proteins encoded by the genome of a certain species and have been asked to find candidate proteins that could bind dna. what type of amino acids would you expect to see in the dna-binding regions of such proteins? why?
Biology
1 answer:
Kobotan [32]3 years ago
6 0
The type of amino acids I would expect to see in the DNA binding regions of such proteins are AMINO ACIDS THAT ARE POSITIVELY CHARGED AT pH 7.
This is because, DNA is a negatively charged molecule, for binding to take place on its surface, the other molecule must be positively charge, in order for them to attract each other.
You might be interested in
Please I need help with this
barxatty [35]
TAAGCCGATAAATGCTAACGGTA
6 0
3 years ago
Which of the following resources can replenish themselves by quick recycling and replacement , within a reasonable time , if man
poizon [28]

Answer:

B

Explanation:

because is a natural resources

8 0
3 years ago
Read 2 more answers
What are the broken layers of rock called that sit upon the mantle?
Svetllana [295]
the broken rocks that sit upon the mantle are the lithosphere
6 0
2 years ago
Bobby touches his newborn brother's palm, and his little brother takes hold of Bobby's finger and will not let go. This is known
VARVARA [1.3K]

Answer: conditioned

Bobby touches his newborn brother's palm, and his little brother takes hold of Bobby's finger and will not let go. This is known as the conditioned reflex.

Explanation:

A conditioned reflex is a response or behaviour learned after birth. So, once the newborn acquires this learned response, they can perform them even without thinking about it.

Thus, Bobby's brother (the newborn) holding on to his finger and not letting go shows that it is a conditioned reflex

7 0
3 years ago
What is important in Hubble's discovery about the red shift in the spectra of galaxies? a. It proves the Big Bang theory. b. It
dedylja [7]

Answer:

c

Explanation:

Hubble's brilliant observation was that the red shift of galaxies was directly proportional to the distance of the galaxy from earth. That meant that things farther away from Earth were moving away faster. In other words, the universe must be expanding.

5 0
2 years ago
Other questions:
  • What are two important differences in the structures of DNA and RNA? The sugar of RNA is ribose, rather than DNA's deoxyribose.
    10·1 answer
  • Which epidermal layer is structured to resist abrasion, penetration, and water loss?
    5·1 answer
  • Rivers contain a ________ percentage of earthâs freshwater
    13·1 answer
  • How should molecular clocks be used if not all mutations occur at the same rate?
    13·1 answer
  • 2 Summarize how the Ti plasmid is used to<br> insert genes into plant cells.
    14·1 answer
  • Metabolic regulation
    7·1 answer
  • HELP FAST PLEASE AND THANK YOU
    11·1 answer
  • eukaryotic cells and prokaryotic cells have some parts in common. which of the following pairs of parts would you find in both t
    12·1 answer
  • Identify the plankton
    7·1 answer
  • Organisms such as yeast can reproduce through mitotic division. During this type of reproduction, nondisjunction is possible.
    10·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!