1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
fredd [130]
3 years ago
7

You could say the relative location of Washington D.C. IS:

Geography
2 answers:
kvv77 [185]3 years ago
8 0
C dc is in Virginia on the coast, however not part of Virginia 
Blababa [14]3 years ago
4 0
Your answer is C Northwestern United States next to Virginia. That's because when you go Northwestern opposite of Southwestern so that's your answer.

So your answer is C.
You might be interested in
What causes the different seasons on Earth? A.The way heat energy reflects off of Earth because of the angle at which it hits B.
adell [148]

Answer:

C. The fact that Earth rotates around its axis

Explanation:

The seasons are caused by the tilt of the Earth's rotational axis away or toward the sun as it travels through its year-long path around the sun. The Earth has a tilt of 23.5 degrees relative to the "ecliptic plane"

4 0
3 years ago
Read 2 more answers
Predict the product sequence for DNA replication,transcription and translation process using DNA template of TATAATGAAGTTCCGAGGA
Rina8888 [55]

Answer:

  • Replication: 3' ATATTACTTCAAGGCTCCTATC 5'
  • Transcription: 3' AUAUUACUUCAAGGCUCCUAUC 5'
  • Translation: AUA UUA CUU CAA GGC UCC UAU

Explanation:

First of all you need to know that DNA is formed by nitrogenous bases represented by letters (ATCG). The sequence that these letters present in the DNA are the basis for the establishment of the processes of replication, transition and translation. This is because these bases complement each other and make connections between themselves as follows:

  • Adenine (A) is complementary and makes connections with Timine (T) in DNA and with Uracil (U) in DNA and vice versa.
  • Guanine (G) connects and is complemented by cytosine (C) and vice versa.

Based on that, we can use the sequence 5'TATAATGAAGTTCCGAGGATAG-3 as a model for DNA replication we can say that the sequence of the new DNA strand would be 3 'ATATTACTTCAAGGCTCCTATC 5', since the new strand is built based on the complementarity of the bases nitrogenous.

This same sequence, when used in replication, for the formation of an RNA molecule, would also use the base complementarity, forming an RNA molecule with the sequence 3 'AUAUUACUUCAAGGCUCCUAUC 5'.

The translation, in turn, would use the RNA sequence to form the amino acids that would form a protein. Each amino acid would be formed by the joining of three nitrogenous bases of the RNA sequence, thus the protein would be formed by the amino acids AUA UUA CUU CAA GGC UCC UAU

7 0
3 years ago
Having a healthy response to stress is essential when it is impossible to eliminate
irakobra [83]

Answer:

the correct one is time-management

5 0
3 years ago
Which of the following statements about the standard of living in Russia is false? A. Women in Russia have a higher life expecta
JulijaS [17]
Answer B. is false because studies have shown that women live longer than men in Russia, government provided healthcare does help increase life expectancies and 99.9 % of Russia can read
8 0
3 years ago
Read 2 more answers
What place can u visit in North Korea? Tell me about it​
denis-greek [22]
You can visit Paektu Mountain, Mansudae Hill Grand Monument and lot more.
5 0
2 years ago
Read 2 more answers
Other questions:
  • Explain three strategies wich local municipality is implementing in addressing lack of clean water
    13·1 answer
  • How do barrier islands migrate?
    7·1 answer
  • Please help me! (picture)
    10·1 answer
  • Where are the longest continuous mountain ranges on Earth located?
    15·1 answer
  • How did Poland impact the us
    6·1 answer
  • 4. What is the angular elevation of Polaris in Buffalo NY?
    9·1 answer
  • Cuales paises están encima de la linea del ecuador
    14·2 answers
  • Label the climate types on the map.​
    6·1 answer
  • The Earth's crust is in an equilibrium state, meaning crust is equally being created and destroyed keeping Earth relatively the
    15·1 answer
  • What do we call a metamorphic rock that has coarse-grained texture, minimal amounts of mica, and contains minerals that are segr
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!