Answer:
DNA to RNA to protein
Explanation:
It states that <em>genes</em> specify the sequence of m<em>RNA</em> molecules, which in turn specify the sequence of <em>proteins.</em>
Celular respiration is:
Oxygen + glucose --> carbon dioxide + water
Carbon dioxide and water are both compounds, which makes them both molecules.
They're both byproducts of cellular respiration.
Answer:
The correct answer will be option- B and C.
Explanation:
The cellular respiration is the process of forming energy molecules through oxidation of food. The cellular respiration takes place in four stages: glycolysis, link reaction, Krebs cycle and electron transport chain.
The glycolysis converts the glucose molecules to form two molecules of pyruvate and two ATP molecules but the total number of molecules formed in cellular respiration is between 36-38 ATP molecules. The electron flow takes place in the electron transport chain which helps in the generation of the proton motive force used to produce ATP molecules.
Thus, Option-B and C is the correct answer.
<span>cellular respiration
Hope it helps</span>
Answer:
a. Inversion
b. Duplication
Explanation:
Inversion has the name suggest, has to do with a segment of DNA being reversed from end to end.
In this case here,
Inversion is taking place here.
species 1 ATGCAAATTTGGGCCCATGAATGGTTGCAA
species 2 ATGCAAAAATTTTGGTACGCCGAATGGTTGCAA
Therefore, the sequences in bold in species 1 are observed to be reversed end to end in species 2.
Deletion ❌❌
I am sure it's not feasible because deletion entails removal of a few sequences.
It can be seen that species 2 is longer than species 1, which gives another reason why deletion is not feasible too, as no sequences are seen to be deleted.
I believe duplication is feasible since AATT sequences are repeated once.
Our final answer,
inversion and duplication occur here.
