Let's calculate the difference in nucleotides. The number of difference multiplied by rate of mutations will help to determine how long ago these two species shared a common ancestor.
Species A: GTACCTAAGTTCACCGAATT
Species B: GAACCTAAGGGCACCGAACT
These species differ in 4 nucleotides.
This number should be multiplied <span>by </span>the rate of mutations
The answer is A, Genetic diversity in the new insect population will be lower due to the founder effect
Answer: different organisms have different chromosome numbers
Explanation: eukaryote cells have more than one chromosome
chromosomes are present in most cells all the time (not in erythrocytes), but cannot be visualised except during telophase of mitosis or meisosis
bacterial cells don’t have a nucleus
The process of DNA replication begins with one double-stranded molecule of DNA. The two strands of this molecule separate during replication, and DNA polymerases add complementary nucleotides to each strand. The end results of DNA replication are two identical DNA molecules