1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alecsey [184]
2 years ago
12

If you have 100 apples and you take 30 how many do you have?

Biology
2 answers:
lara [203]2 years ago
7 0

Answer:

100 is the answer.........

Illusion [34]2 years ago
6 0
The answer might be 70
You might be interested in
Which statement best describes a capsid?
Nezavi [6.7K]
C. A capsid is a protein coat that protects the genetic material of the virus
Hope that helps!!
8 0
4 years ago
what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
VLD [36.1K]

Answer:

Tfftfxggfddsd

Explanation:

Because of the condons

7 0
3 years ago
31. How many calories would it take to raise a persons body temperature 3 degrees if their
dedylja [7]

Answer:

.....................

5 0
3 years ago
The difference in the concentration of dissolved particles from one location to another is called a
Anvisha [2.4K]
I believe this difference in concentration of dissolved Particles from one location to another is called a concentration gradient.
7 0
3 years ago
32 pointsssssssssss PLS I NEED HELP If a bunch of flowers represents a tissue in the human body, what does each flower in the bu
MakcuM [25]

Answer: A cell

Explanation:

The tissue is inside of the organ, which is inside of the organism, the next thing would be a cell, and then after that the next smallest would be a molecule

6 0
3 years ago
Read 2 more answers
Other questions:
  • How and why the plagioclase feldspar in basaltic rocks differs from that in grantic rocks
    7·1 answer
  • Which is a function of the protein maromolecule?
    14·1 answer
  • Use the drop-down menus to identify the correct stage of the Calvin cycle based on the descriptions given below. In this stage,
    15·2 answers
  • In Pennsylvania, wolves have been extinct for many years. They used to feed on white-tailed deer, but not that the wolves are go
    13·1 answer
  • The characteristic of the human immunodeficiency virus (HIV) that makes it different from other RNA viruses is that it _________
    13·1 answer
  • What helps move undigested waste materials to help the intestines to function efficiently?
    12·1 answer
  • The presence of a beard on some goats is determined by an autosomal gene that is dominant in males and recessive in females. Het
    13·1 answer
  • What is the maximum number of degrees of longitude possible
    11·2 answers
  • Human-induced environmental changes can affect living things at which level(s)?
    9·1 answer
  • Why do scientists use scientific names to refer to organisms?.
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!