1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Elena L [17]
2 years ago
6

Task 1

Biology
1 answer:
podryga [215]2 years ago
6 0

To write a diary about a journey through the Silk Road, we must take into account all the aspects that we experience daily on this journey.

<h3>How to write a diary?</h3>

A diary is a written resource that was used in ancient times to make a daily written record of a trip, crossing or territorial discovery.

In general, diary are primary information resources that allow us to know very precisely how past events unfolded.

To write a diary about a journey through the Silk Road, several aspects must be taken into account, such as the different cultures with which the merchants had to interact.

Additionally, we must take important aspects into account such as the location and the date on which we write that diary, for example:

  • Constantinople, January 1215

Learn more about diary in: brainly.com/question/1757970

#SPJ1

You might be interested in
What is the molar mass of a substance?
Ipatiy [6.2K]

Answer:

The correct answer is: the mass in grams of one mole of a substance

Explanation:

The molar mass of a given substance corresponds to the mass of one mole of this in grams. Corresponds to a physical property of the substance. Example: the molar mass of water (H20) is:

Molar mass H20 = (Mass H) x 2 + Mass 0 = 2 x 1 g + 16 g = 18 g / mol

7 0
3 years ago
Read 2 more answers
How are consumers and producers similar?
stealth61 [152]
They both need nutrients to carry out life functions
4 0
3 years ago
What’s the difference between alleles that are codominant and those that are incompletely dominant?
gulaghasi [49]

Answer:

Codominant- when both are expressed like in flower red and white are codominant so they mixes to get a pinks flower.

Incomplete Dominants- is when a where cow and brown cow mix the offspring are brown with white patches

5 0
3 years ago
What is not an example of a fragmental sedimentary rock?
madam [21]
Hey friend!
Let's figure this out

Fragmental sedimentary rocks include shale, sandstone, conglomerate, <span>salt, </span><span>breccia, </span><span>limestone, </span><span>chert, </span><span>dolomite, coal, </span><span><span>siltstone, and gypsum.

As you can see, Gneiss is not listed among examples of fragmental sedimentary rock. So your answer is B. 



Hope this helps!</span></span>
7 0
3 years ago
_________ of animals reduces the level of circulating reproductive hormones leading to increased longevity, typically due to red
Lerok [7]
<span>Sterilization of animals reduces the level of circulating reproductive hormones leading to increased longevity, typically due to reduce cancer mortality. The primary aim of animal sterilization is avoiding overpopulation, but this increased longevity could be an added benefit for an individual animal.</span>
8 0
3 years ago
Other questions:
  • Select all that apply
    11·2 answers
  • Cells use ATP as a source of energy to carry out various functions within the cell. In order for ATP to be useful, a chemical re
    14·2 answers
  • An animal cell: the human body. Different but also alike. Your blood vessels, veins, and arteries are like a transportation syst
    11·2 answers
  • Identify the organelle where photosynthesis takes place. <br><br> B<br><br> C<br><br> D<br><br> E
    10·1 answer
  • Which principle states that, in undisturbed rock layers, the oldest rocks are on the bottom and the youngest rocks are on top?
    13·2 answers
  • 1-5 For the following DNA sequences, replicate the DNA<br> 1. ÇATGGCCTGTAATCCAGCTCGAGTCAAGCC
    13·1 answer
  • Oceans, coral reefs, and the coastal zones are types of<br> ecosystems.
    14·2 answers
  • Why do meteors light up in the atmosphere?
    13·1 answer
  • Construct a triangle ABC if AB=60mm,BC=70mm,and AC=60mm. Name the triangle formed.​
    8·1 answer
  • Which category of veins are the main conduit for blood, are surrounded by muscle, and have an accompanying artery
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!