1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
GaryK [48]
3 years ago
6

If you would like the same label to appear in the first ten cells of column a, you should _____.

Biology
2 answers:
BaLLatris [955]3 years ago
8 0

Answer:

Copy and paste by using special function (ALT+E+S+V)

Explanation:

It is easy to work on excel as it allows to increase efficiency by easing the completion of repetitive work.

In this case when same label is to be copied to ten different cell of a column, then one can do the following -

a) put the cursor on the label that is to be copied

b) Press ctrl + C to copy the label

c) Now select the columns in which the labels are to be copied

d) Press ALT + E+ S+V and select format if only format is to be pasted.

Salsk061 [2.6K]3 years ago
4 0
If you're talking about excel then you would select the cell with the label you want and click "Format Painter". Then, you click and drag it down the first 10 and it will automatically apply that same label to all the cells. 

You might be interested in
Which of the following statements violates the cell theory? A) Mitosis produces new cells identical to the parent cell that divi
nadezda [96]
The correct answer would be A
7 0
3 years ago
Read 2 more answers
How do I use a codon wheel to solve this sequence of DNA?<br><br> AGTACCCGTTAATTAGTTGCCG
Mariana [72]

Answer:

Group the sequence into sets of 3, triplets we formally call codons. These codons will be part of mRNA. Then match those codons using the wheel with their corresponding amino acids!

6 0
3 years ago
Once at the target tissue, _____ soluble hormones bind to intracellular receptors inside the cell membrane.
mel-nik [20]
In this scenario, once in a target tissue, the water soluble hormones which is the answer would then bind to the intracellular receptors inside the cell membrane. Hope this is the right answer and would be of big help then.
6 0
3 years ago
A scientist asks a question and discovers that increased temperature decreases the number of offspring that an organism produces
aleksley [76]
 A scientific question is a question that is based on observations and that is testableThe scientist asks a new question about the impact of climate change on the species because the results of the investigation led to new scientific questions. Correct answer: C

4 0
3 years ago
1. *All of the following statements about invasive exotic species are true EXCEPT:
Alexeev081 [22]
Except for e they tend to have low reproductive rates
8 0
2 years ago
Other questions:
  • Which of the following organisms would be members of a pioneer community on bare rock? A. grass B. lichens C. herbs D. moss E. t
    14·1 answer
  • The piece of laboratory equipment shown would be MOST appropriate for A) heating a beaker of water to the nearest degree Celsius
    9·1 answer
  • True or false: the ability for an animal to use nitrogen in the air depends on the decomposition of animals by nitrogen fixing b
    12·1 answer
  • How does altered ventilation and diffusion affect these processes?
    8·1 answer
  • Which of the following is an extensive property?
    8·2 answers
  • Which statement describes a similarity between the circulatory and urinary systems?
    12·1 answer
  • Which statement best describes the outcome of both meiosis and mitosis
    8·1 answer
  • Name the level in the hierarchy that describes the smallest unit of life
    13·1 answer
  • Which three types of hazardous conditions make food unsafe for consumption
    10·1 answer
  • PLEASE HELP SCIENCE
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!