1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
steposvetlana [31]
3 years ago
12

How do your shoulders and elbows move in different ways?

Biology
1 answer:
qwelly [4]3 years ago
6 0
Our jionts and muscles.
You might be interested in
Order the steps that occur as a protein is synthesized within a cell and finally excreted for use outside of the cellITEMMove Bo
Elis [28]
Nucleus, mRNA, Rough ER, Ribosome, Golgi Body, Cell Membrane.

This question is kind of tricky since a protein would be within the nucleus AS an mRNA sequence and within the rough ER WITHIN a ribosome.
9 0
3 years ago
Read 2 more answers
There is a population where the frequencies of allele 1 and allele 2 are 0.7 and 0.3, respectively. Allele 1 has a selection coe
Lorico [155]

Answer:

0.8

Explanation:

There is a population where the frequencies of allele 1 and allele 2 are 0.7 and 0.3, respectively

Let's use GG to represent allele 1

Let's use gg to represent allele 2

So we can equally say that;

GG = p = 0.7

gg = q  = 0.3   ( from Hardy-Weinberg Equilibrium)

So, given that the selection coefficient = 0.2

We known that the cross between GG and gg will definitely results to (GG,Gg and gg)

Then the fitness of these genes can be represented as:

1 - s, 1 and 1 - t respectively.

Thus. the allele 1's genotype fitness can be determined as

= 1 - s    ( where s is the selection coefficient)

= 1 - 0.2

= 0.8

6 0
3 years ago
Read 2 more answers
A. Producer<br> B. Primary consumer<br> C. Secondary consumer<br> D. Tertiary consumer
Veseljchak [2.6K]

Answer:B. Primary consumer

Explanation:The reason why Its b because that primary comsumers are mostly herbivores or the primary comsumer is the first consumer to eat the producer.Hope it helps!

3 0
2 years ago
Can you please help with this question?
Orlov [11]

Answer:

Mutations increase genetic variation and the potential for individuals to differ

Explanation:

Mutations can result in an organism having a new allele. When that organism produces offspring their offspring are most likely to inherit the allele created from the mutation which could potentially lead to genetic variation.

8 0
3 years ago
Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence (59)GCGCAATATTTCTCAAAATATTGCGC(39
umka2103 [35]

Answer:

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Explanation:

<em>The complementary strand is :</em>

(5')GCGCAATATTTTGAGAAATATTGCGC(3')

<em>The base sequence of the complimentary strand is:</em>

(3')CGCGTTATAAAGAGTTTTATAACGCG(5')

Because this sequence is self-complementary, the individual strands can form  hairpin structures. The two strands together may also form a cruciform.

Hairpin structures can be formed by sequences with inverted repeats through two major mechanisms.

  1. DNA is single stranded in cellular processes such as; during replication on the template for lagging-strand synthesis,  bacterial conjugation, natural transformation, and infection by some viruses. Single stranded DNA can fold into secondary structures recognized by proteins, involved in site-specific recombination, transcription, and replication.
  1. Hairpins can also be formed from double-stranded DNA  as a cruciform. A cruciform is a structure consisting of two hairpins extruding through intrastrand base pairing from a palindromic or inverted-reverse sequence.
6 0
2 years ago
Other questions:
  • In order for a population to survive, sexual reproduction must produce
    13·1 answer
  • What role does hypothalamus play to regulate the body temperature?
    6·1 answer
  • One of the negative aspects of using nuclear power as an alternative energy source is
    6·2 answers
  • Which valve prevents blood to flow from the right atrium to the right ventricle
    6·1 answer
  • Growth of bacteria in food products causes a need to "time-date" some products (like milk) so that shoppers will buy the product
    10·1 answer
  • DNA: ACA            CAA          TGC  
    8·1 answer
  • Describe two factors that are responsible for regulating the cell cycle. What is their role in the regulation process?
    7·1 answer
  • Decomposers (like bacteria and fungi) are not included in this food web. Explain the role of decomposers in nature. Why are they
    5·1 answer
  • A neuron that stimulates the gastrocnemius muscle receives signals from multiple areas of the brain. This is an example of
    6·1 answer
  • What do you think is the central question left unanswered by many origin of life theories? Reflect on
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!