1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Westkost [7]
3 years ago
6

Which part of the body contains enzymes that break down starch into simple sugars?

Biology
1 answer:
MAXImum [283]3 years ago
8 0
The enzymes that break down starch into simple sugars is called amylase. Amylase can be located in the salivary glands, pancreas and the small intestine. The enzymes act as a catalyst and speeds up the breakdown of the starch.

Hope This Helps!
You might be interested in
Give an example of each type of macromolecule.
Xelga [282]
Carbohydrates

Carbohydrates are polymers of carbon, hydrogen and oxygen. They can be classified as monosaccharides, disaccharides and polysaccharides. Carbohydrates are found in starch, fruits, vegetables, milk and sugars. They are an important source of a healthy diet.

Nucleic Acids

The nucleic acids include DNA and RNA that are the polymers of nucleotides. Nucleotides comprise a pentose group, a phosphate group, and a nitrogenous base group. All the hereditary information is stored in the DNA. The DNA synthesised into RNA and proteins.

Proteins

Proteins are the polymers of amino acids. These include the carboxylic and the amino group. There would be no lipids or carbohydrates without proteins because the enzymes used for their synthesis are proteins themselves.

Lipids

Lipids are a hydrophobic set of macromolecules, i.e., they do not dissolve in water. These involve triglycerides, carotenoids, phospholipids, and steroids. They help in the formation of the cell membrane, formation of hormones and in the and as stored fuel.



8 0
3 years ago
Which statement explains a difference between a cell wall and a cell membrane?
lyudmila [28]

Answer:

B cell membranes protect a cell,and cell walls do not

3 0
3 years ago
HURRY!!!! The science of classifying organisms based on features they share is called _____.
crimeas [40]

Answer:

Taxonomy

Explanation:

Taxonomy is science centered on classification of species.

7 0
3 years ago
Read 2 more answers
Cheetahs survived an event that brought them close to extinction. The few survivors repopulated the earth with the cheetahs we h
Annette [7]
I think the answer is B hope this helps

4 0
3 years ago
Read 2 more answers
What do angiosperms reproduce with?<br> A.spores<br> B.seeds<br> C.cones<br> D.amniotic eggs
Tcecarenko [31]

Answer:

b

Explanation:

4 0
3 years ago
Other questions:
  • I only need one sentence. Will mark brainliest.
    12·1 answer
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • Which of the following foods are a good source of water soluble vitamins
    7·1 answer
  • Use the words to label the white blood cell
    12·2 answers
  • What is an abiotic factor that can be found in a rain forest ecosystem
    6·2 answers
  • For your physical anthropology research project, you report that you measured the length of 150 gorilla thighbones, and you sugg
    11·1 answer
  • Why do the sun burn people
    7·2 answers
  • How does a decrease/decline in a top predator impact biodiversity in an ecosystem?
    9·1 answer
  • Which statement is true?
    12·2 answers
  • Help please
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!