1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
alexdok [17]
2 years ago
7

An agricultural manager position

Biology
1 answer:
Leni [432]2 years ago
8 0

Answer:

D. Success and wealth in buisness and investments.

Explanation:

You might be interested in
Most irregular galaxies are thought to have formed _____. from nebulas that cooled very quickly right after the big bang from co
Brums [2.3K]
Most irregular galaxies are thought to have formed from <span>collisions between other galaxies.

This is just one wat that irregular galaxies are formed; the collision is due to the interaction of their gravitational forces. These galaxies might have been regular before the collision, but are not deformed. 
Another form of irregular galaxies are the ones that are still very young and therefore have not yet reached their symmetrical state.</span>
6 0
3 years ago
Read 2 more answers
What does the nucleus of the cell control?
Lapatulllka [165]

Answer:

cell growth and manipulation

Explanation:

The nucleus of the cell controls cell growth and manipulation. This involves regulating gene expression, initiating cellular reproduction, and storing genetic material necessary for all of these tasks. In order for a nucleus to carry out important reproductive roles and other cell activities, it needs proteins and ribosomes.

8 0
3 years ago
Read 2 more answers
When solutes move AGAINST their concentration gradient (move from LOW concentrations to HIGH concentrations), it must use ______
zloy xaker [14]

Answer:

Active transport

Explanation:

4 0
3 years ago
Which vitamin, found in many orange and green vegetables, helps the immune system, builds body tissues, and helps in mucous prod
Arisa [49]
The answer is Vitamin C otherwise known as Ascorbic acid. It is naturally present in some foods, added to others and available in dietary supplement. Fruits and vegetables are the best sources of vitam C. Citrus fruits, tomatoes and tomato juice and potatoes are major contributors of vitamin C. 
8 0
3 years ago
____________ is a polysaccharide that is found primarily in plant cells as a form of energy storage. it is ____________ and as a
zvonat [6]

Answer;

-Starch, moderately branched

-Starch is a polysaccharide that is found primarily in plant cells as a form of energy storage. it is moderately branched and as a result, it is not very soluble in water.

Explanation;

-Polysaccharides are long chains of monosaccharides linked by glycosidic bonds. Starch is among the three important polysaccharides that are composed of glucose, others being, glycogen, and cellulose, are composed of glucose.

-Starch and glycogen serve as short-term energy stores in plants and animals, respectively. The glucose monomers are linked by α glycosidic bonds.

-Glycogen and starch are highly branched, which is an advantage in that the enzymes that build up and break down glycogen and starch act on the free ends of the polysaccharides. The branching thus ensures that plants and animals can quickly add to their energy supply when energy is plentiful, or break it down the storage molecules when energy is in short supply.

3 0
3 years ago
Other questions:
  • Compare and contrast an ecosystem driven by photosynthesis to an ecosystem driven by chemosynthesis.
    7·1 answer
  • In the initial period of learning, ________ describes when an organism learns to connect a neutral stimulus and an unconditioned
    5·2 answers
  • What is the mRNA sequence to match the DNA sequence below:<br><br> TACGCTCCATATCGCTAATCGCCGGATCAGATT
    14·2 answers
  • Based on the diagram above, which organism will have the greatest physical difference from its ancestor?
    11·1 answer
  • ✓
    7·1 answer
  • Which part of the brain controls body movements and processes information from the sense organs? (1) Cerebral cortex. (2) Pons.
    15·2 answers
  • Summarize the key factors DNA polymerase requires to replicate DNA.
    8·1 answer
  • List 2 adaptations that helped Darwin's finches survive.?
    8·1 answer
  • What extra information does a table give than to a bar chart
    10·1 answer
  • Index fossils are the remains of species that existed on earth for relatively short periods of time. True or False? Why
    10·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!