1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
NeX [460]
2 years ago
15

A biodiversity hotspot is a region that has lost at least

Biology
2 answers:
likoan [24]2 years ago
6 0
To be classified as a biodiversity hotspot, a region must have lost at least 70 percent of its original natural vegetation, usually due to human activity. There are over 30 recognized biodiversity hotspots in the world.
aleksandrvk [35]2 years ago
5 0

Answer:

diversity throughout all living organisms

You might be interested in
PLEASE ANSWER ASAP
adoni [48]

1 : D

2 : A

3 : D

4 : C

5 : B

4 0
3 years ago
Read 2 more answers
Amino acids for- GACAAUGAAAGUUAGCAUGUGGUUGUGACGAAAG
trapecia [35]

Answer:

idk

Explanation:

im very sorry about this but i dont know the answer

7 0
3 years ago
Are humans multicelluar organism or unicellular organism​
drek231 [11]

Answer:

multicellular

Explanation:

7 0
3 years ago
Where does most APT production take place in a cell?
Alja [10]
In the Mitochondria
7 0
3 years ago
What would happen to a food web if we remove the:
salantis [7]
C) Primary Producer. The producers are what make the food chain. Without them there would be no primary consumers. And without primary consumers there would be no secondary consumers.
3 0
4 years ago
Read 2 more answers
Other questions:
  • What is A gas that is released into the air and soil during the process of breathing and decomposition
    12·1 answer
  • Assume that a point mutation changes the codon AUU to AUC. Why is this a silent mutation?
    5·1 answer
  • Data must be considered valid for scientists to trust conclusions. which is the best way to increase the validity of data in an
    11·2 answers
  • The biomass of a plant consists of all of its living tissues, including both the aboveground shoot system (stem and leaves) as w
    14·1 answer
  • Galaxies who shape seems to follow no set pattern are classified as
    10·1 answer
  • Soil bacteria are responsible for any steps in the nitrogen
    13·1 answer
  • A major difference between sound recordings made by Emile Berliner and those made by Thomas Edison was that ______. Group of ans
    11·1 answer
  • Which system protects to the cardiovascular system?
    9·1 answer
  • Everybody meu-nbht-zzn
    14·2 answers
  • Next Alicia places each part of the cabbage into its on plastic bag and adds a wet paper towel to each bag. She seals the bags s
    8·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!