1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ra1l [238]
2 years ago
11

The term ____________________ describes one-celled microscopic organisms, some of which cause diseases in humans.

Biology
1 answer:
IRISSAK [1]2 years ago
8 0
Answer will be germs like bacteria, virus, fungi, and protozoa that can cause disease
You might be interested in
If 20% of a DNA molecule is adenine what percent is guanine
WINSTONCH [101]
30% sorry if it's wrong
5 0
3 years ago
The failure of the attempt to reintroduce clapper rails in California was an example of the _____.
Lemur [1.5K]

The correct answer is option D, difficulty of redesigning workable ecosystems

Reason -

The area that was redesigned into an ecosystem actually failed to attract the endangered species of clapper rails in California because of the following two reasons –

a) Failed attempt of restoration of Cord grass ( a tree which is a dominant tree in the nesting habitat of clapper rail) . Even if few such trees were there they could not grow to their full height and thus were incapable of providing adequate nesting cover

b) Due to the lack of predatory insect, some herbivore insect in the ecosystem attacked the green grasses thereby making the nesting inadequate.

7 0
3 years ago
Which of the following is a requirement for a population to be in Hardy-
nevsk [136]

Answer:

B. The population must be very large.

Explanation:

6 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
What is a possible advantage of genetically modified crops
mario62 [17]
<span>They can rais the number of crops produced in an amount of time, they can also reduce the need for harmful pesticides. However, they may cause more allergies in humans, producing a health risk.</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • If granite were subjected to intense heat and pressure it would most likely change to
    10·1 answer
  • How would the membrane shown in the transparency behave if its fatty acid tails consisted mostly of unsaturated fatty acids?
    5·1 answer
  • The DNA sequences that make up the genetic code of an organism determine which traits the organism will exhibit. How are the ins
    11·2 answers
  • Light that appears white or nearly white to humans is made up of
    14·2 answers
  • A Group of students performing an experiment collect Euglena samples from a pond and keep them in darkness in a vessel containin
    13·2 answers
  • drawfism and digantism are growth disorders.which gland might be malfunctioning with these two disorders
    6·1 answer
  • Sienna decides to study movement in plants. Identify the correct sequence of the scientific steps, and place the steps in order.
    11·1 answer
  • Match the following.
    14·1 answer
  • Not all of the human genome codes for proteins. Which of the following characteristics describes about 50 percent of the
    14·1 answer
  • PLEASE HELP ILL MARK BRAINIEST. Complete the table using the codon chart. THANK YOU!!
    14·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!