1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
Alik [6]
3 years ago
13

1. How many food chains make up the food web?

Biology
1 answer:
viva [34]3 years ago
8 0

Answer:

A food web can be formed by more than one food chain, since the webs includes all possible interactions that can occur between individuals of different trophic levels.

Explanation:

Based on the scheme shown in the image

<h3>1. How many food chains make up the food web? </h3>

This food network is made up of three food chains

  1. <em>Plant → Bird → Snake</em>
  2. <em>Plant → Insect  → Bird → Snake</em>
  3. <em>Plant → insect → Frog → Snake</em>

Food webs often include several food chains, since they are due to the interaction between organisms at different trophic levels, which actually happens within an ecosystem.

<h3> 2. Which organism is an herbivore? </h3>

In this case, both the insect and the bird are herbivorous organisms, since they feed of the producer, which is the plant.

<h3> 3. Which organism is an autotroph? </h3>

The only autotrophic organism is the plant, since it is capable of manufacturing its nutrients from sunlight and inorganic matter.

<h3> 4. Which organism is a third-order heterotroph? To what trophic level does that organism belong? </h3>

The third order heterotroph is the snake, since it feeds on other animals.  The snake is a carnivore and can be a secondary or more commonly tertiary consumer, so it can be placed in the 3rd or 4th trophic level.

<h3> 5. Which organism is an omnivore? </h3>

According to the scheme proposed, the bird is omnivorous, since it feeds on both plants and insects.

<h3> 6. Which organisms belong to more than one food chain? </h3>

In this case, the plant, the insect, the bird and the snake are part of more than one food chain.

  1. <u><em>Plant → Bird → Snake</em></u>
  2. <u><em>Plant → Insect  → Bird → Snake</em></u>
  3. <u><em>Plant → insect</em></u><em> → Frog → </em><u><em>Snake</em></u>
<h3> 7. Which organism belongs to more than one trophic level? </h3>

The bird can be located in both the second and third trophic level, being a primary consumer —when it feeds on plants— or secondary, when it feeds on insects.

<h3> 8. What are decomposers? From which trophic levels are the organisms that decomposers feed on? </h3>

Decomposers are generally bacteria and fungi, organisms capable of degrading organic matter, thus enriching the soil. Decomposers can feed on any trophic level.

<h3> 9. What does a pyramid of energy show about the amount of energy available at different trophic levels of a food chain? </h3>

As the ascent of the pyramid occurs —or at the upper trophic level— the amount of energy available decreases. This is because from one trophic level to another only 10% of the energy can be used. If a plant has 5000 Kcal available, the herbivore that consumes it can only use 500 Kcal.

<h3> 10. Why do different trophic levels have different amounts of energy?</h3>

The main <u>reason for the difference in energy in each trophic level is that energy is lost in each one of them</u>, which the organisms use in their metabolism. A consequence of the metabolism is the loss of energy as heat, which is acquired by the environment.

You might be interested in
The Lincoln family has 3 children, 1 girl and 2 boys. What is the probability that their 4th child will be a boy?
goldfiish [28.3K]

Answer:

1/2

Explanation:

You have a 1/2 chance of having a boy and a 1/2 chance of having a girl.

Unless the question specifies whether or not there is a mutation present with the male parent, it is safe to assume there is a 50/50 shot of having a boy or girl.

4 0
2 years ago
Read 2 more answers
The double fortification process involves adding which nutrient(s) to salt ?
densk [106]
The double fortification process involves adding iodine and iron to salt. It is a method used to fight micronutrient deficiencies in developing countries. Iron and iodine are two of the most important micronutrients involved in cognitive function, maternal and infant survival and human productivity. This is a cost-effective method that ensures that the population receives these nutrients without having to change their eating habits. 
4 0
3 years ago
Read 2 more answers
Why did dna technology lead to more use of cladistics?a. it showed that the linnaean system was the most accurate.b. it changed
Alexandra [31]
The correct option from given options is "b", that is <span> it changed ideas about which animals were closely related.
</span>Cladistics<span> was </span>invented for the purpose of improving on taxonomy and it is a way to deal with biological classification. DNA technology lead to more use of cladistics because it changed ideas about which animals were closely related and also it showed new evolutionary relationships between animals.
8 0
3 years ago
Read 2 more answers
BLAST (Basic Local Alignment Search Tool) is a powerful tool for comparing unknown sequences to sequences in online databases. I
storchak [24]

Answer:

This is a well conserved sequence.

Explanation: BLAST a way to match or align a string of DNA or protein sequence to those that are already in a database. The way that this is done is by using statistics carefully to calculate the significance of the match. The BLAST result will produce 4 categories Max Score, Total Score, Query cover, E-Value Percent Identity. The Accession will indicate database of the sequence. In this Sequence: AAGACCCGCCGGGAGGCAGAGGACCTGCAGGGTGAGCCAACCGCCCATTGCT covers over 98.08% identity to the coding sequence (cds) of insulin. This sequence appears to be in a conserved region for many of the listed organism. This suggest that this part of the coding sequence for this protein is highly conserved

3 0
3 years ago
Why would it be pointless for reptiles to sit on their eggs to incubate them as birds do? (2 points) Reptiles have teeth with wh
Alika [10]
The correct answer is: 'Reptiles are ectotherms and cannot raise their body temperature above that of the environment'. Birds sit on their eggs to incubate the eggs as the body temperature of the adult bird warms up the eggs. Birds are <span>endothermic homeotherms, and maintain a constant body temperature. In contrast </span>reptiles <span>are ectothermic poikilotherms, and their body temperature depends on the temperature of the outside environment.</span>
6 0
3 years ago
Read 2 more answers
Other questions:
  • In early spring, many wildflowers begin to grow,
    9·1 answer
  • Decaying matter found in soil
    15·2 answers
  • Fertilization occurs when _____.
    11·2 answers
  • A group of small fish live in a lake with a uniformly light-brown sandy bottom. Most of the fish are light brown, but about 10%
    12·1 answer
  • Please please help
    11·1 answer
  • Physical removal of an invasive species is an example of _______.
    15·2 answers
  • Which of the following is a source of unrefined carbohydrate?
    8·1 answer
  • Which of the following is not a function of astrocytes?guide the migration of young neurons, synapse formation, and helping to d
    13·1 answer
  • Explain the theories behind cloud seeding and its formation.
    10·2 answers
  • Please Help ASAP <br> 15 Points ! Please answer within 10 Minutes!
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!