1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
tatiyna
2 years ago
6

Diego is conducting an experiment to investigate how temperature affects chemical change. He has three pieces of cheese that he

just bought from the store. He left one piece of cheese outside, one on the kitchen counter, and one in the refrigerator. His prediction is that the piece in the refrigerator will not mold, the one on the counter will mold a little, and the one outside will mold a lot. Select the conclusion The piece of cheese in the refrigerator had the most amount of chemical change. The piece of cheese on the counter had the most amount of chemical change. The piece of cheese in the refrigerator had the least amount of chemical change. The piece of cheese outside had the least amount of chemical change.
Biology
1 answer:
valkas [14]2 years ago
5 0

The piece of cheese in the refrigerator had the least amount of chemical change.

  • Moulding occurs on substances which are warm and moist
  • Mold thrives in warm and humid places
  • In refrigerators, the environment is cool and dry
  • This environment hinders the growth of mold
  • The bacteria and fungi require optimum temperatures to flourish, which is not present in a refrigerator
  • The cheese placed outside and on the counter will grow mold as those environments do not arrest the growth of mold
  • Refrigeration ensures that food is not spoilt

Therefore, the least amount of chemical change takes place on the cheese placed in the refrigerator.

Learn more about mold here:

brainly.com/question/1289695

#SPJ10

You might be interested in
What is an organism that must eat other organisms to obtain energy called?
maria [59]

Answer:

Heterotrophs

Explanation:

6 0
3 years ago
Read 2 more answers
Which of the following investigators was (were) responsible for the following discovery? In DNA from any species, the amount of
Zarrin [17]

Answer :Erwin Chargaff   a Biochemist

Explanation:

He formulated the base paring of double helix of DNA. He reasoned that since the percentage of four  DNA  bases are of this proportions in human;

                                  Adenine=30.9% and Thymine =29.4%;

                                  Guanine=19.9% and Cytosine =19.8%

Then,  the amount of adenine will always be equal to thymine,

And the amount of Guanine equals to cytosine based on this percentages of distribution.  

(Adenine and Guanine are large, molecule of Purines, while thymine and Cytosine are Pyrimidine)  

 

He concluded (although scientist believed, he did not explicitly stated this) that this should be the base paring patterns in DNA molecule. This is the first Chargaff Rule.

His second rule is that the DNA composition, in the relative amount of the four bases Adenine, Thymine, Cytosine and Guanine varies in proportion from one organisms to another. And this is the basis of molecular diversity.

6 0
3 years ago
Which best describes the process of making recombinant DNA? The isolated DNA is inserted into a mechanical vector for cloning. T
weeeeeb [17]

Answer:

C. The sticky ends of fragmented DNA

6 0
2 years ago
What molecule is created when 4 hydrogen atoms bind with oxygen and 4 electrons
34kurt

i say ho8 or something like that

4 0
4 years ago
How does the adaptation help the animal survive and reproduce?<br> Giraffe
GarryVolchara [31]
(A)An adaptation is a characteristic that helps an animal survive in its habitat. All animals must be able to obtain food and water, protect themselves from harm, withstand the climate, and reproduce young so the species doesn't become extinct. ... Without their adaptations, the species could not thrive in that environment.
GIRAFFE-That ability – coupled with the tongue's impressive reach and its tough skin – allows giraffes to selectively browse, plucking leaves from among the nasty thorns brandished by many of its preferred food trees, such as acacias.
5 0
3 years ago
Read 2 more answers
Other questions:
  • What vitamin derivative is used in medications for skin wrinkling and acne. health in later years?
    11·1 answer
  • Which energy resource does not give off atmospheric pollutants?
    11·2 answers
  • Some proteins are composed of two or more polypeptides. Suppose the DNA template strand sequence 3'- TACGTAGGCTAACGGAGTAAGCTAACT
    5·1 answer
  • What happens when you move the microscope stage in different directions?
    5·2 answers
  • An example of a hybrid species that is is breed for greater strength?
    9·1 answer
  • Which one is for which
    5·1 answer
  • Pls, help me with this question
    12·2 answers
  • The distribution of the height of humans is a normal distribution. There are some very y'all people, and some very short people,
    9·1 answer
  • What is photosynthesis?​
    5·2 answers
  • Help please what is eaten by what?​
    9·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!