First, you must know what the stop codons are: UAA, UAG, and UGA
Whenever this sequence is read, it signals for an end in transcription and amino acids will stop being formed
Thus, 5′−GGCCCUUUUAGGGCCUUUUU−3′ contains a cue for transcription termination as it will stop after the codon "UAG"
population density are habitats, food, mates, and ... Decreases.
The answer is C. Schizoaffective Disorder
Schizoaffective disorder is a combination of symptoms of schizophrenia and mood disorders, such as depression . . . . cycles of severe symptoms are often followed by periods of improvement . . . . symptoms may include delusions, hallucinations, depressed episodes . . . " (Source Mayo Clinic)
Answer:
REEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEEE
Explanation:
its easy, its A
You may find hypothesis and also a bunch of experimental information