1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
erma4kov [3.2K]
3 years ago
5

What kind of bond exists between two amino acid in polypeptide

Biology
2 answers:
Radda [10]3 years ago
8 0

Answer:

Explanation:

The bond that holds together the two amino acids is a peptide bond, or a covalent chemical bond between two compounds (in this case, two amino acids). It occurs when the carboxylic group of one molecule reacts with the amino group of the other molecule, linking the two molecules and releasing a water molecule.

Gnoma [55]3 years ago
5 0
Two amino acids form a peptide bond together as these are just proteins.
You might be interested in
Identify some beverages that are mixtures. Classify them as solutions, suspensions, or neither. Explain your classifications.
Minchanka [31]

Answer:

See explanation.

Explanation:

Hello.

In this case we can for instance take into account the following mixtures:

- Orange juice.

- Tea.

- A soda.

- Salty water

- Coffee.

Thus, since the orange juice is a suspension as long as it contains different sizes of orange pulp particles that cannot be dissolved mostly because of its organic nature.

Tea can be a solution when we place a tea bag in a cup with warm water since just soluble components of tea are successfully dissolved in the water. Moreover, homemade tea based on some plants are fruits may behave as a suspension due to the oraginic particles that are not dissolved in the water yet suspended.

A soda is a solution of some water-soluble compounds, gaseous soluble carbon dioxide and water which are homogeneously distributed in the solution.

Salty water can be a solution if you put some salt in warm or just cold water and wait until it dissolves completely.

Coffee can be also a solution or suspension depending on how it is made, which type of coffee is used and the amount of coffee added to the hot water.

Best regards.

5 0
3 years ago
On the planet Kermit, in the Muppet population, there are two autosomal loci of interest. The first locus has alleles A and a, a
Kay [80]
Answer: Not c

I couldn't help more.
5 0
3 years ago
( i will give brainliest asap! )Choose one of these two scenarios, and use the scenario to demonstrate the meaning of E = KE + P
Vedmedyk [2.9K]

Answer:

the first one is right ik this i did it give brainliest please

Explanation:

4 0
3 years ago
Super easy. Please help
KIM [24]

Answer:

Identical twins tend to be more similar to each other than  fraternal twins do.

Explanation:

5 0
3 years ago
Is a group of species that includes an ancestral species and all of its descendants?
Alekssandra [29.7K]
A clade is a group of species that includes an ancestral species and all of its descendents
5 0
3 years ago
Other questions:
  • Lisa was wearing her lab coat, closed-toed shoes, and gloves, and she had her hair pulled back. She wore her contacts to class,
    13·1 answer
  • Describe the differences in how the chromosomes line up in the middle of the cell during metaphase 1 of meiosis and metaphase of
    9·1 answer
  • The name given to the genotype where both alleles are recessive for a particular trait
    7·1 answer
  • Help me plz
    12·2 answers
  • What do you like and dislike about today?
    14·2 answers
  • Which of the following motions causes day and night?
    9·2 answers
  • Myoglobin transfers oxygen obtained from hemoglobin to mitochondrial proteins involved in the catabolism of metabolic fuels to p
    15·1 answer
  • In the 1950s, Stanley Miller performed experiments to study the origins of life. He created an atmosphere rich in methane, hydro
    12·2 answers
  • what is the sequence of mRNA codons that are synthesized during transcription that go with TACCGGATGCCAGATCAAATC, TACGGGGGCGTAAC
    5·1 answer
  • Prior to cells growing and dividing the chromosones, which are made of DNA, are copied. This process is known as...
    8·2 answers
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!