1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
mart [117]
2 years ago
10

What is a membrane???????

Biology
2 answers:
Kisachek [45]2 years ago
7 0

Answer:

A membrane is a protective barrier which controls what comes in and out. They are generally found in both plant and animal cells and it acts as a sort of gate into the cell.

Vika [28.1K]2 years ago
6 0

Answer:

Membrane is a barrier which protects what comes in and out...

Explanation:

Hope It Helps!!!

You might be interested in
The two layered sac that covers the heart is the
Liula [17]
The two-layered sac surrounding the heart is the pericardium.
Hope this helps!


7 0
3 years ago
I break down organic matter into simpler compounds. I am a?
Feliz [49]
Decomposer hope this helps
3 0
3 years ago
Read 2 more answers
Two students are comparing scientific experiments to investigations. They came up with the following ideas.
balandron [24]

Answer:

Explanation:

Student A because it requires a hypothesis

7 0
3 years ago
Read 2 more answers
Item 8
Alecsey [184]

Answer:

D) found in a limited time span

Explanation:

Index fossils are the remains of living organisms for which we have already established relative age. These are fossils that only existed during a limited period of geologic time and are easily identified, found in large volumes, and found in many different locations around Earth. Due to these factors, index fossils may be used as a guide for comparison in determining the relative age of an unknown object.

have a nice day and mark me brainliest! :)

7 0
4 years ago
Read 2 more answers
Bacterial degradation of cellulose and fermentation of glucose occur in the rumen of cows, sheep and other ruminant animals. The
kirill115 [55]

Answer:

glucose, volatile fatty acids

5 0
3 years ago
Read 2 more answers
Other questions:
  • A gardener accidentally trims the leaves of a green plant too short. The leaves are now much smaller. He notices that the plants
    15·2 answers
  • Establish a relationship between the systems, bone and muscle, that is, how the two systems must necessarily act together.
    12·1 answer
  • Denaturation of Nucleic Acids A duplex DNA oligonu-cleotide in which one of the strands has the sequence TAATACGACTCACTATAGGG ha
    15·1 answer
  • American scientist, Linus Pauling, was one of many scientists racing to discover the molecular structure of DNA. Pauling initial
    7·1 answer
  • Physical and chemical changes occur during digestion an example of a chemical change during digestion is
    7·2 answers
  • What is the purpose of completing three trials?
    11·1 answer
  • In the previous activity, you chose an animal that interested you and listed three examples of innate behavior and three example
    11·1 answer
  • 6. Lactic acid is a byproduct
    14·1 answer
  • If something increases in size but not complexity is it alive? <br>​
    11·2 answers
  • The single stream recycling program that they partner with makes it convenient to
    5·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!