Answer:
TACTTCGAGAAAACCAACGAAAAGTGGTAA
Explanation:
Transcription is the process by which a strand of DNA is copied into mRNA.
Remember that in mRNA, U (Uracil) bonds with A (Adenine).
Hope that helps.
Answer:
viruses are not fit into broadest taxanomic system because:
they are not cells
they do not reproduce their own
they do not respond to stimuli.
Explanation:
viruses have capsid and are not cells. to be a cell they must have a cell membrane while viruses lack cell wall. they replicate by using the host machinary in which they are causing infection. they are acellular and obligate intracellular parasites of anials plants fungi and bacteria.
