Answer:
controlled the fertilization process.
Explanation:
Mendel took precautions to avoid contamination by pollen through self pollination of the P generation. He controlled the fertilization processes between the plants. He self pollinated the first pureline varieties to form the P generation. He then cross pollinated them to get F1 generation. Every step of his experiment was controlled.
AUGCGAGGUAUAGCGAUUAGCGGCCUAGUCUAA because A goes to U; T goes to A; G goes to C; C goes to G.
Do you want the answer or know how to get the answer?
Answer:
When we look at reproduction too they are similar. They both produce gametes that fuse to form a zygote. They both have DNA that replicates to produce copies of itself.
Answer:
D.4
Explanation:
It contains a carbon atom that bonds to six other atoms instead of the four we have been told carbon is limited to. Atoms form molecules by sharing electrons. Carbon has four electrons that it can share with other atoms
