1answer.
Ask question
Login Signup
Ask question
All categories
  • English
  • Mathematics
  • Social Studies
  • Business
  • History
  • Health
  • Geography
  • Biology
  • Physics
  • Chemistry
  • Computers and Technology
  • Arts
  • World Languages
  • Spanish
  • French
  • German
  • Advanced Placement (AP)
  • SAT
  • Medicine
  • Law
  • Engineering
ioda
2 years ago
8

When a pigment molecule in a light-harvesting complex absorbs a photon of light, what happens to its excited-state electron?.

Biology
1 answer:
MA_775_DIABLO [31]2 years ago
8 0

When a pigment molecule in a light-harvesting complex absorbs a photon of light, While returning to its ground state, the electron transfers some of the energy from its excited state to an electron in a nearby pigment molecule.

  • It takes a photon of light energy some distance before it reaches a pigment molecule like chlorophyll.
  • An electron in the chlorophyll is "activated" by the photon. The energy imparted to the electron then moves from one pigment molecule to another until it reaches the reaction center, a pair of chlorophyll a molecules.
  • An electron in the reaction center is then excited by this energy, causing it to break loose and travel to the primary electron acceptor.
  • Therefore, it is said that the reaction center "donates" one electron to the main electron acceptor.

learn more about light-harvesting complex here:

brainly.com/question/7025086

#SPJ4

You might be interested in
What is the most likely reason that a long beak could be an adaptation for a bird living in a temperature forest?
natita [175]
It probably needs to dig in the ground for worms and grub. So it's an adaptation for finding food.
7 0
3 years ago
The relative humidity would be ________% if the actual water vapor in the air was 10 grams per cubic meter, the air's capacity t
lys-0071 [83]

Answer: The Relative humidity is 50%

Explanation: Relative humidity is the ratio of the air’s water vapour content (the actual amount of water vapour in the air) to its water vapour capacity at a given temperature. It depends on temperature and the pressure of the system of interest and it is usually expressed in PERCENTAGE; the higher the percentage, the more humid the air/water mixture.

The formula of Relative humidity (%) = (water vapor content / water vapor capacity) x 100%

Where: Water vapour content is the actual amount of water vapour in the air. Which is 10g/cm³ from the question above;

Water vapour capacity is the air's capacity to hold water vapour. Which is 20g/cm³ from the question above.

Therefore, RH(%)= (10g/cm³ / 20g/cm³) x 100 = 0.5 x 100= 50%

This means that the air contains half of the water vapour it could hold at 20 degree Celsius.

5 0
3 years ago
Read 2 more answers
Which of the following would have an effect on an object's weight?
dybincka [34]
I'm guessing changing gravity
8 0
3 years ago
Read 2 more answers
What would happen to the enzyme phosphatase if we decrease the PH to 3
Maurinko [17]

Answer:

it will ex plode

Explanation:

4 0
3 years ago
TACAAACACTATACCGCGTAAATGATT Write the complement to the strand of DNA shown above, break it up into the proper triplets.
netineya [11]

Answer:

The complementary base pair is ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

Explanation:

As per the complementary base pairing rule of DNA

C pairs with G and vice versa

A pairs with T (in DNA) or U (in RNA)

Breaking the given strand into triplets, we get -

TAC  AAA  CAC  TAT  ACC  GCG  TAA  ATG  ATT

ATG  TTT   GTG   ATA TGG  CGC  ATT  TAC   TAA  

5 0
3 years ago
Other questions:
  • What are ribosomes in like real life?
    13·1 answer
  • A direct visual examination of the mucous membrane lining of the sigmoid colon is a diagnostic procedure called:
    6·1 answer
  • Water is an abiotic factor in terrestrial environments.
    13·1 answer
  • Pick twenty foods and research the amount of total carbohydrates, sugars, and other carbohydrates in them. Note: Most food label
    8·2 answers
  • Select the best answer for the question
    8·1 answer
  • Which two microscopes generate three-dimensional images?
    7·1 answer
  • The oldest known fossils Group of answer choices all of the choices. are microscopic. are that of prokaryotes. date back 2.5 bil
    6·2 answers
  • In the scientific method for discovering answers to a problem, a hypothesis must
    6·1 answer
  • Where are most of the ATP molecules produced in aerobic respiration?
    13·1 answer
  • What can be told about the age of the fossils in the diagram?
    15·1 answer
Add answer
Login
Not registered? Fast signup
Signup
Login Signup
Ask question!